Description :
From Genome Similarity Track
Location :
Scaffold_13:460347- 463871
Transcript NameFunction/comments
Physo_531324Hypothetical protein

Sequence
3524 bases(100 bases per row)
ACCGTTGGAAAGACAGAGTCAAGCCGCCGAGCTGCCGCTGGATAAACGCCCGGGCATCTTCTGGTAGGGTTGTCGGGGTGAAGTGGGCGCGATCAGGGTA
GATGTACTGTGATGACGCACCCACCACACCGGGGCACCCGCGCCGGGACAGCGACCGAAGACACAACTTTCGTCCATTCTGCTGGGGGAGATACTGCGAG
CGCTCGGAGGAACTGCGCTGACTGCCGCGCTGCTGGGCTGCGTCCTGCTCAGGTCTGCGCGCGACCTGCTGTACGACCCGGCTCCGGTGTTGCTCGACGG
GTTCGCGGCCGCGGCTAAGGTCTGGTGCCGGTCTCTCCTGTCGGATCTCGCGCAACTAGCGCTGCGTGAGCAGCTGGATCGTAGCTTGGAGCTCGGGGTT
CGTTCGATTAACCGTGTCCTTCACACAACGGCGGGAGGAGCCACCCGCGATGTCCCGGACAGCGGCGGCACGAAACGACTCGAGGATACCGTCCACCCAG
TAGACAAAAGGAGGCAGGTCGGATGGTGCCCATACTGCCGACCCCGCTTCCTCGAGCGCAAACGCGTGGATCCGCTGCACCAAGTCGACCACCTCCGACG
ACGCAAAGCTAGCGCAGTAGGTATGAAGGCTGTTGATCGCCGAGACGACTTCGGCCGACGAGGTCGGAAATAGCGGTGCCGGTAGAGCGACGATGTAGGA
AAAATTCTGCATATTGGTGTGACGCGTTTGTACCCAAGTCATCTTTTCCACGCGGTCCATAAATGCGAGGTGCATAATGGAGAGTCCGCGAGTCCCAAAT
TGAAAATCGTAGAGCCGAATCAACACCCCGGGGTGCGGAGCGAACTGGACAGACGCGTGCGAGATGAGACCATCCAGGAAATCATGAGCACACGTACCTC
CCAAGCCCGAAGACATGAGCAGCTGGTGAAGCTGCGACTGCGTGGAGCTCGGCTGAAATCCGGATTTGGGGGCACCGGCCAGGTCGCTATCGGTGGCGAC
GCTTAGCGGGCGGCGCCACAGCGTTTGTCGACTGCTCCAGGTACTCCACCAGCAGCTCGGGTTGGCCGGCGAGGGCGCGAACGACGCGCGCGTGTGCGTC
CGCCGTATCGCCGCGCACGCGCGTTGGTGCTGCGTGTGAGTCCATAGGGGTCCGCCCGGTGGTCTCCTCGACGAGTCGGCAAAGAACGAATCCGACTGAG
ACGCCGACTCGTTGTGGCCGATCAGAGCCTCCGGATGCATCGAAGACCGGCCGGTATCTGGTGGACAGGAAAAGGACGCTCCGATCCGTTCCCGCAGCTC
GTCCGGGATCATCCCGGCGGGATGTACTCGGCATCCCCTTCCGTCACATAGACGAAGTCAACAGCGTGCTGGAGCGGGAACGATTGGTCGATTCCGGTTG
CTTGATCGATCCATGTTCGGACGTTGATGATCCGCGCGTGGCACGATATCGGCGAGGATGGTGGCGATGTCTCGAGAGGGCGGCCGGTCGGGTGTGTGCG
GTGAACCGAGGATTCGATCCATTAGTGTGACGTGGAGTGTACGAAGCTGTGAGACGCGCCGAGACCGCGGCACTGCTGCGTCCCACAGCAGCAAGCACGT
GACTGGGTCCACCACCGTCAGCTCTGGGATGTGGTTGTGCTGCCGTGCGCACCACCACGCGAGCTGAGTCTTGAGCGAGGGCGACCACCTGCCCATGGAC
CCAGGCGGACCGCAGGCGAGCCGCAACCGCCCGACGGAGCCATTCACCCGGGCGCAGTCCTCGTGCAGTTGCAGCTGGGGCGCGCCGCTCCGTAGAAGTC
GTGCGGGGCGTAGTCCACTGCAACTGCGAATTGGGGATTCCGGTGACGGTCGCTGGTGTCTGCGTTACCCTGGCGACGATGCCGTATGATGGGACATCTA
GGTCGACTGCATCTTCTGGTAGGAGTAAGACGAACTCGCCGCAGGTGATGGTTGCTGTCATAGTCGGTATGCCGTCTGATGCCGCGCTGGCACGTTGCTT
GCTCGCGAGATATTGCTAACTGAGTAGAGCTAATGCTCTGCCGCGCGTGTGGTGGCCTGAGTGCCAACCACTTCGTCTCCTGCAAAATCCGTTTTCCCGA
TCCTGCTTGCTCGATCATCTTCGCGAAAAACTGATCCTTCACTGACGCGCGAGCAATCAGCGATTAGAACACGATGAGCATATGCCCATTTATTGGCATC
GATTAAACCATTGCAAATGTCAAGGGAATGGCCACCATTGATAGCCGCTAGCTTCGAGAATTCGTCTTGAAAGTATAGTCATACTCATGAGTTTTAGAGA
ATACGTTCGAAGTACCAATCGTTACTTGGAAGTTTCGAATGCTTGCACCAGGCATGACCGTCCAAGGAGCGCTGTCAAAAGGAGATTGGAATTGTTGAGT
ACTATGAGCACTAACGAAGTGACCCTTCGACGTTTCAGCAAATGGAAGCAATGCAACATATTTGATGTCTTTGAACGTACCGGATAGTTGGAAGTTGAAG
TTAGCATTAACCCTTTCGCGAGTATCCTCAATAAATTATAGTATACAACTCATTGATACTTCCTTCTAAAAGGGCGCTCTAGGCGTCCTTTTACAAAGTT
ACGGAGCTGTCTCATGGGACATGCCATCAACGGTGATTTGCAGGATACATAGAGTGTATGCGTATGACTTAGCATTTGTATAGACAATGATTACTTGATG
ATTACCCTGCGTACCGATTATGATTTGTTTTAAAAGAAGGTTGATTACTAGCTTGAACTTGTGCAAAATGGCACAGGATGCGCCCTTTAAGAGGGGGTAC
ACTCTACCGTGTTTTGGAAAATCATCTAAACAGCACTTTCTGTATCCTTTTACCGCGAAAGGGTTAAGTTGACCAGCAATGGTATCGGGCGTCGTATCAG
CGCGACCGGTGAAGTATTGAGCATAAACATCCTTAAGGCGAATATGCTTAACAGGCTTATTAATAATTGAAGTAGCGCTTCCACTTGCAAAATGAAGGGT
TAGGTTAGATGAAGATACCTGTCTTTTGTAAAGTTACCCTAACCCTGATCAGGCCGCTGTTGCCCGCGTGAACGTGAGGAATTGAAGCTGCTTCCAGTTC
AATTGGGTTTTGTATACATTTTAAGTCAGAAGCAACTTCCACCTCTAGAAACAACAAAATATGCAAAGTCCAATTGCATGACTAATCAACGCGCAGTATC
TTTAGAGTATTAACCAGTCATAACGTCCACTTTAGTATTAATTTTGCAAGGATATTTGATAAAACTAAGGACGACGGTAATAATCTTTAGGAGGCTTCTG
AGGACTTGAAGATAAGGTAACAAGACTAAAAATACTAGGTTTTCTAACAAGACCTTATGTACTACGACAAGACATTAAATACTAAACAAGACTGAAAACA
CTACGACAAGGCCAACAATACTTGCATTAATCTCGGAGGTACGCGTGCCTGGACTTCACTAGACGACGTTTACGGTCGAGGCGAATGTATCGGGCCAGTG
TAGTACATTGATGTCTGAGCTGGC