Description :
From Genome Similarity Track
Location :
scaffold_3:460269- 462458
Transcript NameFunction/comments
Plaha_PHALS_12746Prosaposin

Sequence
2189 bases(100 bases per row)
TCGCTATTCGCAGAATTTGGGCCTTGTGTTGCGCAAAACTTTAACTCTGTACAAATAGCCTTAGAACTCATACCTTTGGTAATTCCGTCAATGACAAAAT
CAAATTCCTTCATGTAGACATGACAGGGGTTGTCCGAGCCAAGCATATCACAGATCATGTCAGCATAAGCGCGAACTTCACGAATATCGGTACCATACTG
CTGGAGAGCAATCTTCATGGCAGTGGTGGCAAATTGGCAGTACTTGCACTGAGTCGTGTTTCCGGGATGCCACAGAGAGGCTGTAACTGCGCCCTCAATT
TCGTAAGCGATAAATGGTGCAGCATCATCCCAGCGCTGATTCTTGTTGCAAACATTCAATACCTCGCAGGACTCAAAAGAGCGCATGCCTCCGTTTACCA
TTTCTGCGATCTTGTCAAACTGCATGTCGAAAAAATCGCAATTGTATCTTGACGGTACAAGGGTGCAcacatttgataaaatattCTTGAAATTCGGTAG
CTTTCCAGGTGATGCGAAATTAAGGTGATGAATTACCTCAGCAACTCGCGAGCAGAAGAAGCAGCTATCGTGAGGCAAGTACACATCACCGTTTAACATG
GCCCAATTTTTATTAGCTTCAAGTCCCACCATCCGCATCACATCAAGACGGGAGATCGCATCGAAATCAGATGTATGGTCTGCAATCTCAGACGGGCAGT
AGCTCAACGTCTTGCAAATGGCACGAGGGTGCACtcctttttttaaagaatcAATAACAATGTCCAACTGGTTTACATACTGGTGGCACGGACTTTCTTC
TCCCAACATACCGCAAATAATGTCAGCGTAGTCGCGAATTTGTTCAATCTGATCAGGAGCCTCCTGTAAGACCACCTCTACCACAGTCGTAGCTGCATCA
CAGTACACACACGACTTTTCATTTCTTATTGTCGGGTTTGATGAAAGAATGTCATTTAGAATGTCTACATGACAGAAACTTAAGTCGGCGCAAATGTCAC
GCGGATAACGATtcagctgcaccagctccACGATCTGATCAAATTTTTCTTCCACCTCCCCGCACTTGGATTCCGATAAAGCGGTCACGCACATCATTCC
TAAAACCGACTTGACGATAGGAAGCTGCTCGGGGAACACTTCATTGACATGGTAAATGACACCTGCGACGTGGCTGCAGAACACGCACGACGTGTCGATA
TTTGCGGAGTCAATCACCACTAAAGAGTTGTCCTCGACCATGAGAGAATCCGGAGAAGATAAAAAAGTATTCAACGCTAAACTGTCCGTGTCGCTGACCG
ATGGGCACATGGCAATTCGGGTGCAGATAACTAGGGGATCAGTGTCGTGCTTAAGCATGTCTACAACTTCGTCATAGTTTTTCAAAAATGTGTGGCACTG
GGAGTCGGCTGACATGGCGTCGCACAAATCACCTATAATAGCTCGAACTTGTTGTACCTGCTGTACCTCCTGGGACAGCGCCTGATCAACCATATCCACG
AATCTTTCGCACAACTTGCACGACAGATTGTTGGCGTTTTCCAGATCCGAGACGATCTGCATAACTTCGCACACCTCGTCGTCAGTCTTGTCCATCATCA
GCAACTTTTTAACCGTATCCTTCGCGTCCACAATCGACTTGCACTGTAAACAATAAAACATCATTTAAGTACTAGTCTTTAATGTGATCCATCACAAGTA
AGAAAGGTGTTTCGCACCTGCATTACTAAATCGACAAGCTCAAGATCATCGCACGACGACTCGCCCCAGATTCGCAGCGATATAACGCCAAGAACTGGGC
GAAAAATATCCAGTAGCGTCTTCGTCTCAGTCTGTAGCTGATCCTGCTCATGAATGTTTTGGACCGCCTTCATGCATGCGCGCTTCCTATCATCCGTCGA
GTTTGACATCTTGGAATCTTCATCAATCACAAAAACACGAAGGACGTCATTCTGATGTTTCTCAGCACCGAAAAAGCGCTGCAAGAAATCCCCTGACAAC
TGTATGTGTTCATTCAACGAGGCGGTTAATGCCGCGACAAAGTCCTTGCCCTCTCCCTCCTGCTCGTCTTGGCGAGATAGATTAATCTCTCCTGAATCAT
GAATGCCCAGCTCAGCGCTCACAATCGCCGATGAAGCGACCACACTCAAAAGCAGCGGGTGTACAAGACGCATTCTTCCACTCTCTCCC