Description :
From Genome Similarity Track
Location :
contig_61:46018- 47430
Transcript NameFunction/comments
g11329.t1hypothetical protein
g11330.t1POM80027.1 Hypothetical protein PHPALM_2185 [Phytophthora palmivora var. palmivora

Sequence
1412 bases(100 bases per row)
GAAACTACTCGCGCGTCGTGGACTGGTGGGCGTTTGCGTGCGTGGTGTACGAAATGGTCAGCGGTTCCCCGCCGTTCACGACGCGCCGCAACGGCTCGCA
CTTTGAGCTCTACACTCGCATCCTCTCGGGCAAGATCTATTGGCCGCGGTACATGCAGAGCTCGTTGAAGGACTTGCTGCGGCAAATGTTGCAGCCCGAC
CCAGCCAAGCGACTGAGCGACGCAGCGGATATCAAGAAGCACGTGTGGTTTGAAAACGTAGACTGGGACGTCGTCCCGCTCCGACAAGTGGCTGCGCCGT
ACGTCCCGAGACTGGCCTGTGCAGGCGACACGACCAACTTCGACGAGTACCCGAGCTCATGCGAGGAGACCCCACCGCTCGATAACGACCCCTCTCGACA
AGAGTTCCGCAACTTCTGACACGCAGCCCGCTACGACGGACATCCAAATCGCCACAACAATCACGCCAAGGTGGCAATCATGGCGAGGGAGTCCAACGAG
CCAGACGTGCTTCACCGATTACCAGACGCTCAATAATTCGTCCTGGTACGGAGCGGCAGATGGCACCGCAGCGTCGTGAACGTTTTACGGTGAAAGTGCT
GCATACGCGTCACATGGCGACCGTATGAACTCGACGAACAGAAGCAGCTCCTGCCACTTTGCGCCGTCTGCAGAACACTTCAACAAGGGCGATACAGCGC
GCTCATGGATTTTCAAACGGCTGCAACATACGATCGTTCACTGCAGCTTGGTACGATGAGAGTCGGGGCTGCCAGCACTTCTATCACCCCCTACTGTTTC
CAAGCAAGCGGTATGGATGGCCACCTCGGTATTCAAACACTCGACGCAATCTACCGGAGCAGCGGGATCTGTAGACAACCAGCAGTGGAGCAACGACAGA
TATTATACATACCAGCAGCGAAAACTCAATAAAGTCGACTTCCATGGTGGCCGAAATGGCTGGGGAAAGGCGAGACAGGGTTTGTTTCGGCTGTCCTTCT
CCGCTGTTTCGGTTTCACTATAGCTGCTCGCATCGTGAGTGCTTTGCCGCCACCTCGGGCCTCTTCACTCGAGAATCGAGACTGGAGCGTTCACGTCCAC
GGTGATTCGTGGCCCGAGCGTCCGAGGAGAAGCCGAGAAGAAGTGCAGGAGCTGCAGCGTGCAGAGACCGGCAGCGAGCGATACAAAGCCACAAGCGGCT
TACTCAGCGCGTCAAACATGGCCAAAGACAACCACAGTCCGTCCCTGGACCCGCTGCACTCTCCAGGAAGCGACACACCGCAGCAGCAACAGTCTCCGGT
ACGCAGCACCTGGAGCAGAGCACAAGACGCCGCCAAACAGAATCAGGTTAAGCAGGACACAGCGGACCCCATGGCCAAGACCAAGCGACGCCTGTTCTCG
ACGCCTCTGCTG