Description :
From Genome Similarity Track
Location :
contig_8:460016- 461463
Transcript NameFunction/comments
g1883.t1hypothetical protein

Sequence
1447 bases(100 bases per row)
TTAGCTAACATTAATCTTGGCAACGAGATCTATGTGGCCGCCTTCTGGTGAGCGCGGGACCCACAGCACCAATGAGCCACCGCCCGACCCGGGAAGGCCA
AGGAGACCCGGACGCCACCGGTCGAAGTACATGGTCTTGTCCTGCAGCGCAGACACTGTCGAGTTCCACGTCACGGTCTCGCCGCTCTTGACCTTCACAG
AGTCGACGGTCTCACCGGCCGAGTGGATCTCCACAGTCACGTCCTCCGTGTCCGTGCTCTCGAACACAATGTTCACGGCGCCGTCACCAGCGTGTGTCCA
AGTACCGTAGCTGTCGGCGAATGCATCACCATCGGCAGCGAGTGCTAGAGCGTCGGCAAGCGATCCGTCGTCGATTTCACCGATGAAAGACGTGGGCCCG
CACACCGGCTGAATGTACTCCTCGAGCATAGCAGCAATGCCCGTCGGATCGAACATTGCAATCACGTCCAGGCCCATGTCTGCCACCTTGAGGATGTAGT
CCGCAGTAGAAAGAGCGTTGCCGCCGCCGTCGTCGGAAGAGTCGACCAGGTTGTCCGTGATCAGACTCAACGCGGTCCTAATCTGGTCTCGTACAGTGTA
CGCGTCGCCCGTGATGTTTTGAATGCAGTTGTTGGTCACCGTAGGGATCTCGGTCAAGAAGAGCGCCGTGTCGCTCATCGCTAGACGGATCGCACTCACG
GTAGACGTAGCATCGGCCGTCTTGATGTCGGCAACAGCCTGCGTAACCTTCGTAATGATCGACTGCAGCTCCGTACCGCAGGTCTTGCCCTCCGAGATGA
GTTTCTCCAGTGTCGACGCGGCGTCCTCGTTCAGCGACTCTACGGAGCTACCGGCACCGACCGCACTAATGAAAGTCTTGAACGTGTCGACGCTGAGCAG
TGAGGACCCCTTCTCGACGACTTGGATGAGCACCTTGTCGACAATACTCACGACCTCGGACGCCAGGTTGAGGTAGTCGGTCGGCACATCCAAGCCGAGA
CAGACACAGACGGCGGTGGGTAGGTCCTTGACGACAATGTCCGAGTTGTTCAGGAGCGAGATGATCTGCTCCTCCGTGCCGTTTGGGAAGCTGGTCTGCA
GCCTCTCGGCGTAGCCCACGATGTCGTCCACGACGGTGAAAAGTTTCTGTCCGCACTTGACGCCCTGCTGTACCGCAGCGCTGGCTGTGCTCAGCTGGCC
GACTCGCCAGAGGTAGCGGCGTTCAGCGCCACTTTAGCGACGGACTCGATCTTGTCGATGACCTCCAGCGCACAGTCATCGTTCTGGGGGATGCATTCCA
TGCCACACTGCACGGGGTAATTCAGCGGGCACTGGGCCCAGCACGTGGCGATGCTGTCGTACGCAAACCCAGCGGAGCACGTACTGGAGATGTATGTTTT
TCGGTAGCAGGCGTCGTCGGACGGGTCTACCGTGCCCACCCAGTTTG