Description :
From Genome Similarity Track
Location :
Scaffold_1220:460- 2634
Transcript NameFunction/comments
Phyke_g11667hypothetical protein PHYSODRAFT_340298
Phyke_g11668hypothetical protein PHYSODRAFT_340298

Sequence
2174 bases(100 bases per row)
GTCAGATAATCCGCAGCTTGATTGAAGTCACGTTTCACATGGACCAACTTCACCGACCCGAACTTCTGTCTAATCGAATTAAACTCACtgaggagaagct
gcagcttcggctGATTACAATTGATCAACCCTTGGGCTTGCTGGATCGCAATTCTTGAATCACCTACCACAACCAGGTCATAGATTCCTTGCTCAAGCGC
CATCGTGATTCCTCTGATCATTCCATGGTATTCCGCGTCATTTACTGTGATATCTTCTAGAATGAAGCCGCGAGCACTCACTACATTCCATTCCGGGAGT
TTCCACAAGATACACCCGCAACTGCCACGCCTATCAGAGGTTTTCGCTGCTCCGTCAAAGCTGAGGAGGTAGCTCGAAAAATTATTCTCAAGCATCTCCA
AGCTTATCGGTGGGGCCGGTACTACTCGCCCTTTGTTTAGAATTAGAGATTCTGCAATCTTGTCGAGGTGTTCACGAGAAGTAATACCTGCTCCTAGAAT
AGCAGCAAGTCCATCCTCATCTTTCTCAACACGACGAACTTCCAAATCCCAGGGCGACAAGGTCGCTGCCCACCTCAGGCATCTTCCTTCTAGTGACTTC
GATACGAAAATCCAACGCAGGACCGAATAACGCGTATACACCTTGAGGTAACAACCGGAGATCAGCGTATAAAACACTCTCAAGACTCGTAGCAGTGCTA
CTACCTCTTTTTCGGCCGGATGATACCTCAATTCTGAGTCGTTCAGCGTCTTGCCTGTGAACCGAACCGGGAGGATTACCCCGTCATACTCCTGTCCAAG
GACAGCACAAGTTGCCCAAGGGTTGGCATGGAGGATCACCACGAAATCTCTTCCACGATCGGGATGGCGTAGCAGCGGTGTCGAGActatcttcttcttc
aagattTCAAACGCTTCTTTGGCACGCCCCAAGTCTCGGCCTTCTCTAATCTGCTCATCCGTCAACTCATAGAGTACAGAAGCGATAACAGGGAGGTCTT
CCATGAACTTGTTATAGTAGCTGAGACTCCCTAGAAAAGACTGGACTTCTTTGAGTGTAGACGGGAACGGCAGATCGGCCACGCCTTTGGCAATCTTAGG
TATCACGCGCAATCCTTCAGCGCTGATCTCGTGTGACAGATACGGGATGGACAGCTTCCCAAACTCACTTTTGGGTAGACTCACCGAGATCCCCCAATAC
CGAAGGCTGAATAGCAGCGAATTCAGGTCTGAACAAAGTTTATCCCAAGTCGGCGCTCCATGGGCGATGTCGTCGATATAAGAGCTTCGCCCCAGGACAG
GCCCCATCCGGAGAGAGGCTGAAATATCACGGTGGAATACAGTCATTCCACTCGTTAATGCTGGGATCCCTTCCTCAGCATCAGTAGCAGGATACTCTCC
TACCTTGATGTCCAAGAATTCCAACACATCCGGATCTACtttggcttcttcatcagGCGGCAGCCGTACGAAACCCCAGAGGCAATTATCCAGCATCTAC
TGATAAATCAAAGGAGCATTCTTCAGACCAAATGGCATGCACATCCACTGGAAGTGCCCAAAGGGGCTTATGAACGCTGAGATGAGCTTTGCTCGTGAAG
TCATCGGAACAGCCCAAAACCCGCTAGCCATGTCCAGGCTCATAAACCACATTGCTTCTTCGAAGCCGATCAGCAGATCATCGATTAGAGGTAGCGGATA
GTAGGACAGCTTAATCAACTGATTCACCATCCGATAATCGATACATAACCTGATGTCcttgctgttcttcttcaaaaTGATCACAATGAGCGAGGCCCAT
TCGGAATCCGAAAATTCAATCAGACCTGTTTCcaggagcttcttgatcaacTCATACACCTTCAAGAGATGACGCGGGGTTATTTGACGTGAGCGTTGTG
CAATAGGCTTTGCTTCTCCAACATCCAAATCGCATACTACACCTCTCGCTGGTGCAGGCACAGCATTGCCATCTCCGAGGAAAATAGAGCGGTGGTACTT
GAGAATACCGCACAACTACTGGTTCATCTCGATTGTTGTCTTCTCCTCAACACCAACGtcagcctcatcgatgtTTGCTTTGGGACTCAGATCTTTCAAT
TCCGGGAGAACTGCTAGTTGGTCTCGGAGTTGAGTCAACAACTCGGTTCCTTCGTGGAAAAACACCTCTTCGTC