Description :
From Genome Similarity Track
Location :
Scaffold_3393:460- 1833
Transcript NameFunction/comments
Phyta_totarag15260hypothetical protein PHYSODRAFT_339130

Sequence
1373 bases(100 bases per row)
GAAGAGTGCGGATCCAGCTGATCCAGCCGTTGCCGTGGCCACTGCGGCACGAGTGGGTGAGTCATCCAGATCGTCGGGGTCATATTCCCAGAGAGCGGGG
TGGCGATCGGGTGATCCGACCGGCTCCATGTCCACATCTTGTGCGCCAACGTTCCTTGTCGTGACCGCGACCGGGGTCGGTGCCGTGATCTGCTGTTCTT
TGAGGAATCGGCTCATAGCGGCTTGGAAGTACGATTCCAGTCTGCCTGTTGATCCGTCCGGCGAAGTTACGTTCGTGATTTGGTTTGACTGTCTCTGCGG
CGGCCTCTGTTGTCGCGGTTGCGTCCGATCCTGGGACTTcccacgagatcgagatctCAGTAGTGCTTCTCCGGAAGGTCCGATAGGCATCTGTTGCGGT
CCTATAGATCCATCTGATCCAGGTTCGAATGTGGCCGATGCGTAATGTGAGGAACTAGTCTGGTACTCCGTCACGCTGATCCGGGGCGAGATCTCTGGAT
CTTCGATCTGTCCATTTCCGCCTACCAAGATCGACAGTCTAACGAAGAGCTCTTGGGAAGTAGATTTGACGGTGTCTAGATCCAGATCTAACAGTCCGTC
AACGTCGAATGCACCGGCAACTAGACCTGCCTCTTTCAGCATCTGAAGTAGGTTCTTCACCGCAGTCAGCTTGTTAGACGTCTCCGGCGGAGCTGACACT
NCTTCTGATCTTCGCCTTCCGACTCAGGGGCCTTTATTTTCTTCCGCGTAGTCTTCACttgcgtcttcttcgtatTGGATCTTGGGACTATAGGGCTTGT
GGTCGTTTCTTTCGTCGCGAACACATACGGTAAAGGGTTTTCCTTACCGATTTTGCGTTGCGGTTCTCGATGCGTATCGAGATCCGCTGGGGTCCCCGAA
GGGACANGTGGAGCAGCGTGGAAATCTTCACTCTGCGTCCGAGTATTGGTCTAGATCTGGAGTGATGTAGTCGAACTCCGATCTAGGGGCCGGGGCTGGA
TCCGGGCCGTGGGGTTGCCTTCTGGTTGTGTGTTGGTCCTTTCCTTAGTTGCTTGCCGCTTCCTATAGCGGGAGCTTGGTTGTTGAGActcgagaagatc
gccggCCAAGCAATAAATTCCGGTCGATCGTGCCTTGTACTTAAAAAGTAGATCACTATTGTAGGTAAATCTGGCCAATATATTAATCCAGACTTAACCT
AACGACTAGATCAACTGCCCTTGACGTGTCAACACCTTGTAGGGCTAATGTAGTTCCCTCTTCCTGGCGTTTGCATAGACACTTAAGCAGTCCAAAGCAA
ATTCGAGTCTGAATTATGGGTAGCCTACATATCTACCTTTCCCCATCCTGAGTTTCATCCACAACTAGGCAAC