Description :
From Genome Similarity Track
Location :
Scaffold_1311:46- 4650
Sequence
4604 bases(100 bases per row)
TAACTAGCGACTGGAAACTGGGTCGAGCTAACCTTTTTGCATAAGCTATTATAACACACACGCCCTTACTTGAATATGTCTGTAACATTCCCTCGTCGGT
TAAGGAATCCAGTCAGAGTCTATCAGTGTACACCTGGATCTGGGCTGGATCCACCCTTTCAGCGTACGCCTGGATCTGGGCTGGATCCACCCTTTCAGTG
TACACCTGGATCTGGGCTGGATTCCGGATCGGGGTTGGATCCACGCTTGGATTTCATCCCGATCTAGCGCCAACGACCCAGTTTCAATTGGGTCAGTATA
GTTCGGGCCCTTGAAAGCTCGTGCTTGAAATCAAGCAGGACTCCTCACACGTAAAACGTCACTCTTATGCATAAACATTCACTCCTTCCTCCTAATCCAC
CCTTCCCCTGTGGATTCGTCTTCTCTTTCTTTCCGATGTGACCAACTCACATCAGCGATCCTTATCCTCCTGGCCCACACCCTTCCTGTGGGCCCTTCTT
CATCCTCCCATGGACATGACCAACTGACATCCATGGATCCCCTCCCTACCCTTCTTCATGAGACTGCATCACGCCGAATCTGTTACGATTCGTACGATCC
CTCAAGAAAACATAGAGCAATGCTCTACAGTTCAGATCTGCCTCGTCTACCCAACTGGGTTCGTCATATCCACGCCAATACACCAGAAATACACGGTAAA
TCCGTCCGTATCTAGTTCGCTTCCCCGACCTCATATCGGTGATCTTCTCGACTTCTAGCTCGTCGGCTTCGAGATCCACATTCCAACTATCTTCTGGTAG
GCGGACTTCGTCGAAATCCACCCGGTCGGATTCATCCACCGAAAGACGGGTTTGCGGCCGGTCCGGATATTCCTTGACCAACTTCAGCTTGGATACGTGT
ACTACAGGGAACCAGCGATATTCGGTACCTGCCGTTTTCCAGCTTCACCGCGTGTTCTCCTATCTTTTTCGCTCACCCGGAATTGTCCATGCCATAGATG
GGCCAATTTGCGGGCGTACCCTTCCTTCACCCTATCTAAATAAAGCCACACCTGCGATCCCACTTGGATTTGATGTGGACGGGTCACCCCGGATCCTGTC
TTGGTTGGTGTTCATCGCGAAGGGAAGTCGTTCTGCGTACTCATCCCAATCCCTCTGATCCAAATCCTGGACATACATCTTGAGTGCCCTCGTGATCGTC
TGTACCATGCGCTCGGCCGATCCGTTAGCTTGGGGACGATATGCCATGGTTGCTCGCTGTCTCTGCCCTAGGATCCGGTTGAAAGCTCGAAAGAAATCAG
ACATAAAACCTGGCTCTCGGTCATGTCTAATCATCTCACTAGCCCCAAGTCTTCGGAAAACGCACTCCTCGTACGATTCGGCAATGGTTTGTGCAGTTCA
GACGCACTAGCTTTGGCTATCACGTATCCGGTAAACAAATCCACCCAGATCAACAATTCTGTGTTTCCTTTGAACGACTTGGGCAACGAGGGGATGTGAT
CCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGACATTCCCAGGCGACTCCCCTTCGATCGTGGGCCTGCCCTTGCCTGTCTCACAATCCACACATTC
ACCGCCACACCGTTGCACGCTCTTAGATAGTCCCCTCCAGTGGAAACATTCTCGGATCCGTTGGTAGGTCCGACCAATTCCCTGATGTCCACCTTCTAAA
CTAGCGTGGTAGTGATGTAGGACATCCTGTTGTAAGGTTTCCGGCATCACCAGTCTCATCAATCCATCCCGATCCTCGTTGACTCTCTTCGTAGGAGGAC
AATAGAAGAGCAAGTCATTCAGATCCACTGCATAATCCGTAGCGATCATACTGTAGGATTTGGAATCCTCCCGACTCAGGTCTCGTATATCCCCCATCAG
ATACTTCTTTAGTCCCAAGATCCACGCTTCCTCGTTTTGTGCTTTGAGGATCGGCTCAATGCGGACTCCCTTCACAAATGTGTCCTCGAGGATCTGGGGG
CTGGATCCAACCCTTCCTCTGGACCCAGTGACGGCCATCACCTGGACTGTCCTTTTCCCGGATCCCACTACCACCACTTCGTCTAGTCGGTTCAATGAAA
CGAGATCCTGACGCTCGGCCTCTTTCTCCACTTCGACACCACATTGATCCCGTAAATCGGCACTGGCCAAGCTATCTGCACTGGCATTCCAATCTCGCTT
GACATGCACCAACTCGTGATTCATCCAGCCACGCAGGTGGATCATCACTTTCTGCCGTAACAGTGTTAGGGCCGGGGCCTTGCAGTCAATCTCACCTCGC
ACCTGTCTGATCACCAAATTTGAATCCCCACAAATCACCAGCCTTTTCGGATCTTGTCCCTTTAGTAGATCCAAACCCAGCAGGAGCCCGTTATACTCCG
CTTTGTTGACGGTGAGGCCTTCCGCATAAGTGGATCTGGCCCGTACAACTTCCCATCCGGGTAGTCTCCACAGTATTGCACTGTACGTTCCGCCTCCGCG
TCGTACGCGAGCGGATCCATCGAAACTCAGGACGTACAGATCCTCATCTGCCTGTACCGTCGGGATTGGGATCTGGATCCGGCGTTTGGGCTCTTTCTTA
GGAGCGACCCTAGTCAGCGCCTCATCCATCTTAGCTCGAGGAGTGATGCTCGCGGCCAAGACTCCCAGGATCTCGTCTTCCCCTTATGAACATTTCACAA
TCTCCAGTGTCCAAGGCGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGTAACCCGGCCGACTTGAACAGCCAGGCTAGCGTAGAGTGTCGGGTCAG
GATCCGGATGGATCTTCCCACCAGCAGGTTGTAATTCAGATCCAACACGCGCAGGAGCGCGAGTATCTCTTTCTCCACCGCTCCGTAGTTCAGTTCATTC
GGCTTCAGTGTTCGGCTGACGAAGGTGACTGGATGACAGATCCCCTCATGTTCTTGTACCAGAGCTGCTGAGACTGCCCAGTCGCTGGCATAAACTATTA
CCGTAGGTTGACGTTCTGGATCGAAATGACGGAGGATAGGCGTGGTCGCGATCCTGTTCCTCAGTTCCACGAATGCGTGCTGAGCTCGGATCCACCGAGA
TTCTGCCTTTTCCATGTTCTGATCCGTCGTCTCTATCCAGACTGGATCCTCTCGCCGTTGGCCCCGGGGTGGATCCAGCTCCTGTTTCAGGTCCTCTTCT
GGCGTCGTACCACTTGGATTCCTTCGTGGATCCGACATCTCCCGGGCCAGAGCTTGTTGGATTTTTATCCGGACAGCTGGAGTGGTCATCGCAGCGAAAT
CTACCTTTCTCAATTCATACAATACCGCGGCAAACAGGGCTTAATCCTCGATGAACCGACTGTAGTAGTTTAAACTGCCCAAGAAGGATTGCATCGCCCG
TAACGACTGCGGGAAGGGCAAATCGGCTAACGAAGACAGGTCCTTAGGATTCGCCTCCAATCCCTCCTTGGAATCTCGATGGCCTAAGTAATCCACCTTG
CGCATCCCCCAATAGCTCTTTACCACACTGATAGAAAGATTCCACTTAGTACACGCCTCCAGTAGGGATGTCACTCTTTCGCACAACTGATCCCACGATT
TCGCCGGGATTAGAATGTCGTCGATGTAAGATCTGCGTCCTAGCACGGACGGGGTTCCAGGATCCCCTGGCTCTCCTGCCTCAAATGGATCTACTTCCGT
ATGATCTTCCCCGGATCCACCCCTTTGGGGTTCCGGTATTCGGGTGAATCCATAGAGAGCGTTATCGATTAGACGTTGGTAGATCTGGGGTGCGTTCTTC
AATCCAAACGGCATCCGGTTCCACTCGAACAGTCCAAACGGTGTGATGAATGCGGATATCGCGCGAGCTCGATCCGTCATAGTAACTCCCAAAAACCGCT
GGCCATGTCAAGAGAGCAGTACCAGAGTACTTTATCCAGATCTTCCAACAGCTCATTGATTAGAGGCATCGGATACACCATCAATCGAGTCAGACCGTTA
ACCAGCCGGTAATCTATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTACCACTGGGAATGCCCACGGGGACGTAGAGAAACTGATGATCT
TGGCTTGCAGCAGGCCCTTAATCAGATCCGATAGTTTTTCTCGGAACTGAGGCGCCACCTTCCTCACCCTCTGAGCGATCGGTTTCGCGTCACCGACATC
GATGTCACATTTGACTCCGCGGGCAGCGGGCGGTAACGCATTACCTTTATCAATCAGCAGATGTCGGCTCTCCCAGATTTTCTGACGCAGACGATCCACT
TCAGCAGGTTCATTCGCCCCTGGATCCACTTGGATATCATCAATCGTGACCTCCTCTGTGGTCAGTGGTACCTCCGGGATCACCGCCATGCCTTCTCCCA
GGTCCTCGGCATGTAGATCCCCGCCTTCATGGTAACAAACTTGCTCATCTTCCGTCTTCGTAGGATCCATCATTGGATCCGAACACCGCGGCCTTCTTTC
GCCTGGCAGTCCTTCTGTCTTCGGGAATCAGGTACCCTGATATCAGGAAGACCAACAGTTGGATCTAGTCGGTCCTCTAACGAGTTTAAGTCCGACGGTT
CTGG