Description :
From Genome Similarity Track
Location :
contig_31:46- 3972
Transcript NameFunction/comments
g6033.t1hypothetical protein

Sequence
3926 bases(100 bases per row)
CCTCGCTCGTGGCTAGTAGTGCAGGTTTTAAGGTTGACCGAACTCAACCTTGGTATACAGAGGCGCTTACAACCAACCCGGTGTAAGGGATCGTTCCTGG
TCTTCAGGTGTTGATCCAACGTTCGCTGACCTTTCGCGAGGAAGCGTGTGTTGTTGGTGGGACTCATACCGTTCGGTAGTGAGATTTTCTGCGTGTTCCT
ACACGACAACTGGTGCCGCGACCGGGATTGGTGTGACCTTCTGTGTGTCTTGGTTGCATATAGGTTCTTACCTTAACGAGCATTCGAGAGAAGAAAGAAG
AGAAGAAGAAAGAAGATGGCGAAGAAGCGAAGTCAGCGGTACCAGCAACGCCGGCGAGGTCAAGTGGAACGCGTACGAGGGTTCGGGGCGTTCGGTTCGT
CGTTCGCGACGCGGTACGTTGGCGTCGATCAACGAGCGTTCGGACAGTTTTGATGAGCCGATGGACTATTCTGACGCCAAGGAAGATGACGAAGAAGATG
ACTGGAAGAGAAGGCAGCTATGCCCGAGCTTTCGGAAGCCGCTGCAGTATCTGCAGGACGCAGCGGAGGGGTGAGGTCGCTTGCGCGAACCTCACCGAAG
AGTTGAACGAAGTGGCTGGTCCCGAACCAGCCAACGGTTACGACGAAGATGAGTCCGACGATCACCGATCGTCGGCGATGGCCGAGGATGCGAATTCTCG
GCCGAATGGCGGCCGGCCTCCTCTTAACGGAGACACCCCGGCCGCCAACCGAGTTCTGGGTCGATACCTAGAACTCATGAAGGTAAGAGCAATTGGATGC
GATCCTTCGCTCCAGAGGTTGTTCGCCAAGCCATCTGGATGGAGCTCGGTGGCGAGTTAACTGTGCCCGTGGAGGCGTGGAACACTCGGCAGGTGGCCGA
GGACACGGTGCAACTCCTACGCGCTATGGGATGTGAACCCCAAGTGTTCCCGTCGGAAGCAGACCTCCGAGCATGGGCACCGAGGACGCCGCTACGGCGC
TTCGCAAGTGGAAGCAGAAGCTTCGGTCGGCCTTCGGGGTGGCCGAGGCGGGAGTTAGCCGTCCACCGAACGTCCGCCACGCATCGGATCCGGTCGACCC
GTCCATGATTCCGTTGCCAGTGACCCCTGGGAGACGCCCCAGAGGGTCGACCGAGGCCGGATATTTTCAGCCCAAGGTGCGACGTCGACATATTTCCAAG
ACTCTCACATGGTGACGCCGAGGTCGGTCAGTCGCACAGAACGACTGGCGAGAGAGGCCGGGATATCGAACCGCTCCGACTGCTGGACGAAGTGCAATCG
GACGCCCAGCCGACGTTACGACCTCCGCGATGACTCTCTGACGAAGATTCGTTCGACGTCGGAGACACGGGGTGACTTGACGGGAGAATGGGCACGCCAA
ATTCGTGAGCTGAGCGCTGTGGGGAATGACAGTGCGACACCGAGGCTAGAGATCGCTACGCATCTCCCACTCGGAAACATTAAGCCGTACTTGGGACTCC
GCGATAAGAGCGAGAAGTCCATGCAGTGGCTCCGAGCGTTCATATACGAGATGAAAGGGACGCACACGCCGCCCAACGAATGGTGCATGGCGTTTGAATT
GAGCTCCAAGATGGTGCTCTGCATTGGTACCGACAGCTGCCCCGCAAACGAGACGCACGTGGAAATTGTTGAGCGATGCGTTCATTAATACTACTGTTCG
AGGTTCAACCAGTCTGCGAAGGCTCGGTACTACTCGGCCAAGCGAGAGGAGAAGGAGCATGTCTGCGACTACCTCAACCGACTTAACGGCTATGCTCGCA
ACGCCGGAGTGCAGTTCGAGCATGGCGGTCGTGATGCAAAGGACCACGTCGAGCACTTCTTGGATTCGTGCGAAGACCGAGGTCTAGAAGAGCGTCTGTG
CCATGTCCGAGTTAAGAACATTCACGACCTCGAGGATATGATCAATGATATCCTTCGTCGCAGAGAGCGAAAATCGGGACGCGAGTCCTCGGTCCGCCGC
CTCGAGGGCAAGAGGTAGCACGCCGACGCGATGGTGGCGCTCCGAGGATCCGCGGGAGCTATCGCCGAGACCGACGTCACCGAGAGGACGACCGTCGTCG
AGAAGACCGTTACCGAGACGTAACCGTCGCCGGGATGACCAACAATATCGACCGAGGGTCACTCTCACTGACGCACTGACCAACATAGTGACAGCACTGA
ATGCGGGACGCTGGTGGACGCGCGTGGAGGATACCCGGAAGCGTACAACGACGGATATGATGACACCGAGGAGTATGGGCCGGAGTCTCACTCTGGCGAT
GACGACCGATACTCCGAAGGGTACTCGGACGACGGATACGCGTCGACCGAGGACCGAGGCCACGTGGCTGCCGCAAACGACTCTGAACGTCGCAATGCGG
CTGAAGGAACGTTCGCTCGCGCCGACAACCGTCGGCCGAGGGCAAGTAACGGCCAACGCCGTATGACCGAGACGACCAGCGCCGAAACTCCACCGGACGC
GATGGTCGACGCCAATATGGTCCATGCGCCGCCTGTGGAGGCTCACCCATTCGGCTCACTACTGTTTTAAGCGATGCAAGATGTGCAAACAGGTTCATGA
TGCCGGGAAGTGTGAAGCCTTCCAAGAACTCACGAATCTCCTCCGAGCTAAGGTCGAGAAGAAGGACCTCTCGCCGGAGTTGCAAGAACTCGTCTATGGG
AGTCATTTAAACTAGGCAGCCCGCCAACTGAAACTGGGTTGGTCCCAATCGGGCTGCCACAGTTAGCCAAACCTGCGCTGGATGCGGACTATATGTTCGC
ATTCGCAGGTGTGAGCAAACGGCCTGATGACTTGAATATGGAATATGTGAAAACGACGGAAAATGTAAAGGAGAGAGGCGTAAGCCTCGGTGAGAGTGAA
GTGAATGGACGACGTGTGGACGGAGACGGAGTGGAGCTAACCGATGCTTCGATCCTCAGCATGGCCAAAATCGACCATCCATCCCGAGACCTCGGCCAGA
CGATTAAACTGTTATCTGGCGAGAGAATGGGTGGTGGTCATCCCAGCGCTATGACAAGAGGAAGCGATTGCGAGCCCTCGTCAATGGGGCTGTAAACGAC
TCGCGAACGAGGATTCTGCTGGACACTGGAGCGAATGTCAGTGTGATTTCCGCGTCATACGCGAAACGGTTGCGCTTGCGCGAAGTTCCAGATCACGGTA
GGAGTCTGGAAGTGCGAGGAATTAACCCAGGGGTGATGGAGACCCGCAGACGAGCACTCGTTAAAGTCACGCTAGGCTGGGAGCGCGTGTACGAATTTGA
AGTATGGGTTATGGATCACAGTGCAGGAGTGGACGTGGTCCTGGGAACAGACTTCATGATTCCAGCCGGAGTCCGGTTGGATCTGTTCCACGGTACTGCG
AGACTACCGGACGAGGTAATGGTCCCCTGGTGAAGTCGCAGAACCCAGCAGAGGCCGAGCCGTACAGCATGCAAGTGACTGGACGCCCGACCGAAGATTT
GTCGGTCCCAGGGCGTGAGTGGCGAGAATTTAGGTTACCACGACGACGGCCGCCTCTGACTACTCACGACGTGTGGGCACGCCGGATTGGAAACCTGGTG
CCCACTGTAACGAGGTCTCGACGAGGGCAGCCGACGATGGTGCGACTAACGAACGTGTCACCGAAGATTGCTCACTGCGCGAGACACGAATCGGTACTGC
TGTGGGTGAAAAGGGTGACCTGCCGCAAGGGGATGGATACACTCGTTTGAACTCCGCTAAGTATGAGGAGTGGCAAGTCCTGGCGTACGCGGAGTGTCGA
GACGAGACTTTGTTCGCGCGGGAACGCAAACTCTACGAACGATGGTTGGCAGATCAGCCACCAGCTGTAGAACGACGAGACTATCCGACACCTAGCGGCA
TCCTACCTCGACCATCCGACGACTTG