Description :
From Genome Similarity Track
Location :
Scaffold_486:46- 2117
Sequence
2071 bases(100 bases per row)
AAAGAACGAGAAGTGGATATTAAGTGCCGATTGTCAGCGCTCTTTCGAAGGTATCGAGCAAAGCTTAATACAATCGCCAGTTACAGCGATTGCAGACCAA
GACAGGCCAGTCCACATAGTCTGTGACGCCAGTGACTTTGCAATCGGCTTTGCGTTGGTGCAGTACGATGCAGACGATGCGGAACGTGTCGTCTGTTATC
AATCAAACCAGCTGAAACCAGTAAAACGCAACTACCCCGTCGATGACAAGGAACTCCTTTCCATGAAGTACGCGCTGGATAAATTCATCGTTTATCTGCT
AGGCTATAGATCCTTTATCGTCTATACGGACCATGCATCTTTACGAAGGACCGTAAACATTTCACACCTCTCGCAGCGGATGGCGAGGTGGCTGTCATTC
TTTGCGGAGTACAACTTCGCCGTCGAGTGTAATCCAGGACGACTTAACGTCGTCGCTAACGCACTCTCGCGCCGGCCCGATTCCGAGCCGGCTGCGCCAC
CCGACAATGATCCGACTACTGTCGCGGTACTGACTTAGTGTGTCCCGTCGTCAACTTTATTGGCCGACATACGAAAGGCGTATCATCCAGGGATGGTTCG
ATTGCTGCATCATCTCTAGTAAACATCCGGGAAAAGCCTCAAACTGTTGTCGTCAGTATGTTGATCCTCTACGGATAGATATACAGTTCGCAACGTCTTA
CTCCAAGATTTGGCTTATGCTGGCGACATGCCTCTTGTCGTCGTACCAGATCATCATCTGCGATTGCGTATCATGTAAGAGTACCATGACGCACCTGTTG
GTGGACATAGTGGTCGTGAAAAAATATATCTCGCAGTAAGCCACGACTTTTACTGGCCCCGCCAGTATCAGTTCGTGCGCAAGTACGTTCATACCTCCGA
GGTACGTCAACTGGTGAAGTCTAGTCCTTCCGTGCAGCCCTATTACAGCCTCTTCCCGTCCCGGCAGAGTGCTATGAATCTGTCTCAATGGACTTTGTCT
TCGGATTTCCCGCATACTCTCACAAAAATACTGATATTCTTGTGTTCGTTGACAGATTCAGCAAGATAATACATCTGGTTGCTGTTCTCGAATCAATTAA
CGCATCGGCTTGTGCCCAGGTATATATCGACACGGTCTTTCGCCTCCATGGGTTGACTTGTGAACTTGTGTCCGATCAGGGCCCGCGGTTCACAGCCGAG
TTCTGGCGTTCCGTGTTCAAACACTTGGAACGCGCTTAAAGATGTCCACGTCTACCCATCCTAAAATAGATGGTTAAACAGAAGGCTCCAATCGTGTCCT
CGAGGAGATTCTCCGAGAGTACGTCTATTATTTTACAAAATTGGAGCGAATTATTGCCGATGGTGGAGTTCGCCATCAACAATTCAGTCCATGCGTCGAC
GAAGCACACGGCTTTCTTCGTAAATGGCTTACGCCAACCGCGTCTTCCGACCTTTTTAGAGTGTGACTCTCGTTCAAGGGGGGGAGGGACTTCTTCGAGA
TTTCGCCAATCTGGCTCTCACTCGTCACGTGTCGACAATGCGGTCACCACGTTCGATGCCGATGTCGATCACATCGACTTTGGTGAATAAGAGGAAAGTA
AAAGCAAATATTCTCTTACTAATTATGATACTGATCGGATCAGCATCACGCCTAGTGCGTCCAAAGACACACTAACAGAGATGACAAGTGATCTTGCTAC
AGTAAGATCCAAGAGCACTACAGCTACAGACAGCGAGTCAGCAGATGAGTTCATACTGGCTCGCTAAACGTTTGTCCGTTTCGTACAAGACTCTATCGCA
GAGGCGGTAGTTCGACAAAAACGAAATCCTGACAAGAATGAAAGGGCAAATATTCTTTTATTCAATGGAGGTGACCTTTTCCTAATATCTACGGTAAACC
TACCTCGACACATAGTGAATTACGTTGGTAGTAACAAGCCACAACCCCAGTTCATCAGTCCAGTTCGTGTGCTGCGCCGCCTAGGCAACACACGTACGAT
TAAACTGCCACTTAAGATGAGCACTCATCCTAAGTTTTACGTCGATCGCCTAAGTCCGTACTATCAGTACG