Description :
From Genome Similarity Track
Location :
Scaffold_3849:46- 1939
Sequence
1893 bases(100 bases per row)
AGTAATAGTCTCTTATCGCTGACGTTCGTGACCTGGAGGTATTGTGATCGACCTGGCCCCTGGATTACGGTAGGTACCCATTTCTCGCCCCGAGTGACCC
ACAGTTTCTCATGTTCCACCCACTTTAGCCGGTCTGGCAGCTCCCAGGTTTCCCCGGGCTCGATCCAGGTTGTCTTATCCGCCCTTATGATCCTCATCTT
TGCTCCATACAACGGTCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCGGGGAAACAAAGTGTCCCATCCGCTAGATCCAACCTCACTCCGGCCGGTACC
ATGAAATCCATCCCGAGGATGGCGTCTTGACCAGCGAGATCTCCAACCCAAATATCAACCCAGTATACCAAACAACCTGCCAGCGTGATCTTGATCCGCG
TTCTCCCATTCGTACGGTACACGCCTTCACCAATCCCAACACAGTCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATT
TAGTATAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGCCTGAACCACGTTCCTGGGGCA
TGGTACTTCCAGTATCCACGGGACTCCCCGGTTAGCAGATCCATGGATCCAACATCCTCAGATCCACGGGATCCAGTGACCTGACAGACCTTAGTGGGAT
CTGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGGCCGTGTTGGCGCTTCTCCCAGTAACCACGTGCCTCTGCCCTTTGTAGATCCAGGGTTGAAGG
GACTTCGGAACTGGTAAACTCATCCACTTGGCGCAAACTAGAGATCTTGGCAACTGACACTTCATGTCGATCACGTGTATTTTCGACTGGATCTAGGGTC
CTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAATACCTAGAACGCTCTGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTT
TAACATCTTCTCGACCACTTCTGGCAACATCCCTCTGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGACACTTGCCG
ACGTCGTGAATCTCGCCACAACCGCGACACACGTAGAAGCAATGATCTCCGGGATGACCTTTCTTGCCACACTTATCACAGACCAGATGTTTCCAGCATC
CTGATTCTGTGTGCTTCCGGGATCCGCACTGCGAACACCTGACTTTGTGCTGTCCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTA
CGGTATACCCCGGTCGAGAGTTGTCTCCCAGTCTTCGCCGTACGATCGTTAAGCGTAGTGAGACAGACTCTGCGGTAATCCTCTGGATCGGAGTCCGAAC
CATCGGATCCCAATTCAGTTCCTGAGTCGGGCGCCGTGACTTGGTGGACACGTCGAGCTGGAGCCGTAGGCGTCGGAGCTTTTTAGCGATACTTGCCGGA
TCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACAGCCCGCAGCACTTCTTCAAGATCCTCTGCGTCTGGAAGACGTAACAGGGTCAGTCTG
TCGGCCAGATCCACATCTCCCAACGTCTCGATGAAATGATCCACGTCTTCCCACAGTACCTTGGATCCCCCATCCTTGATCTTCAGCTTGGCCCGTAGAC
CGGCCACATTTAGTCGGTGTAGGGGGACTCATCCGATCTGCGGCGAGCGTGGTAGTATTGTCGTGCCACCGACACCCCCAATCCACAGTACTGGGTTTGA
AAACTGCGCAGCAAATCCGGCCACTTGACCCTAGTGGAGCTGCCCAGCTGCCGATACCAGTTCCTGGAAAGGCCCCGCTAGCAGATCCGCAAA