Description :
From Genome Similarity Track
Location :
Scaffold_816:46- 1830
Sequence
1784 bases(100 bases per row)
GCCACTTCGGGTCCGCGTAGGCGTGCTTAAAGTCTCCAAGTAGACTTTGACGTGGACGTCCCGGTCCGCTGCTGCCAGAATCGCTTTGCCCAGCTCGTCC
TCCGCCACGGAGCGGACGGCCACGTGCAGCGTGTTCAGGGCCCCGTTGACGCACTCCAGTAGAGTGGACTGTAGGGTGGCGCGCGGTGGCTGGGTGGGAT
TCTCCCCTGCATCAGTAGGGGCGTCCTTCCTCGGCGGGTGGAAGACCACGTCGACGAGCAGATCGTCCTCCGGACGAGGGGGGTCGACGGGTGCAGGGTG
CGGCCCGGGGCGGCGCGGCTCGAGGTCGTGTCGGCCCTTCCACAGACCCGTCATCGTTCCTTGGCTACGGTGGAAGTGCTCGGCAACGTCTTTGAACGGG
ACGGCGGCCTTGCCGTAGGTGTCGTCGATGTAGTGCACGATCTCGAGCCGCTGCGAGCGATGAGCCACTTGCAACGCGGCAGTTCTCCGCGCCGCTGCCT
CGTTGCCGAGGTGCCACCCACGCATGGTGGGGCTGTGTGCCGAGGGGCGCGACTGGCGGCGCGCGCTGCCAGGGCTGTCGGAGCCGTCAGAGCTGCTCAT
GCTCACGTCGTCCGCTATCTTCGCGCGCGCTTGACATCCTTCTCTTCCTCGATATACTGGGGGGGAGTGAAATTTAACAACAACGAAATTTAACAACAAT
GTGGTGTCGACCAGCTGAAGGTATCCGATAGTGAACGAGGATTTGTGTCTGGACTTTCGTAGTTGCATGAAAGCCTCGTTGCTAGTACTTAGTACACTTT
AGTCGGTGTCGGAGGAGCTATCTAAGGTAGAGGGGACAAAATCTCGTCGGAGAGCTCTTCGCCGCCGGCGAGCACTTTCATCCACCTGCCTGTCAAATGC
CTGAAGATAATCGACCTCGTTCACTGATAGGCGGCGATAATAATCTGAAGCTCTCGCGAGTAGTTCACGGGCTGATAAACGTGGTGTGGCAGCAGCACTT
GGAGTTCGGGAGTGGCGACGAGCTTCCCGGGATTGCATGGCTGTAGACACAGTTTCTGAGTCCGTACGGGTGGAGTGTCGATGGTGAGGGACTTCTGAGC
GTTCGTGAACCCGCTCACTGCGATGCGCACGGTGGCGACTTTGGCGAGTAGTAGAGTGTCTTTCTCTATGAGATCCGCTTCTAGACGTCGAAGTAGTCGA
ACTCGCTGTGCTGTTCGCACCAGTTGTCGCAGTCGCTGGGCTCGGAGGTGGGAGGTCCGGCAACCCGAGCACAGAGCGTTCAGCACGATGCAGCTCTACA
AGCTTCGCCACGTCACGGTTTGCATGGACTGATGCATTAGGCGAACGGCAAAAGCCACAAAACAAACTCCGCCTCCGTGCTTGGCTCCATGCATCGGACG
AGAAGGTCTTGCCGCAAGCATTCGGTCACGACGGGGTCCTCAAACAGTTCCAGCGAGATGGGGCATGTCAGCACTGCCTCACGCTCCATGAGTTGTCGCC
TGCTCACATCCTGCTGAGTTCTAGCTGCGTCACTCGCATGCTGCAACAACTGGGCTCGCTCTTGATCAAACGCGCTACGCTGCTCATTCAGCCGGTTGCT
CAAGTCTTCTCCAGGTGTTGCAACCTGGATTGCAGGTGTAGGGTCAAGGAAGCTCTCCGAACAGCTATTGCCGCGTTCATACGCCTCCATCAGCCAGCGC
AAGTGAGGCATAGCACTCTCCATTGACGAGTGGATGTCGCCATGGCTACAGTTTCGTTGACTGCCTTGTCGGGGCACTCGGGTC