Description :
From Genome Similarity Track
Location :
Scaffold_2370:46- 1760
Sequence
1714 bases(100 bases per row)
ATCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGGCTCTGCCGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGATTACGCCATCGGGTTTG
CATTGCTGCAGGACAACACGGCTGGGCAGGAACGAGTCATCTCGTTCCAGTCCCGGCAGCTCAAAGCCGCCGAGCGGAACTACCCTGTCCATGACAAGGA
GCTCCTGGCAATGCAATATGCCCTTGTGAAGTTCCGTGTTCACCTTCTGGGCTCTAGGCCCTTTGTGATCTACACAGACCACGCGTCCTTGAGGACGGCA
ACTAACTCGCCTCACCTCTCCCAAAGGATGGCGAGGTGGCTGCCCTTCTTCGCGGAATACAACTTCCGCGTCGAATACAAGCCGGGCAAGCTCAACGTGC
TTGCGGACGCCCTCTCTCGGCGTCCCGACTATGAGTTGGCCCACATCACGCGGGTGACAACGGATCTATACGATCGGATACGCATGGCGTATCGGGACGA
TGAGGCTGTCGTGCCTATCGTCAAATTCCTTAAGGCTGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGACCCCACCGATATGAG
TTGAAGGAGGGCCTCCTCTATTATCGGGTGGAGCCCACTGATCCTCCACGGGTGGTCGTACCCAACGACGAGGATCTGAAGTTCGACATCCTCGCGGAGA
CGCATGACGCGCCCTCCAGCGGCCACTTAGGCCGCGAGAAGACCTTCCTGTCGGTCTCTCAGTCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCG
GTACGTCAAGACATGTGAAACATGTCAGCGGGTCAAACCCGCAGGGCACTCTTCGGCTCCACTACAGAGCCTACCCGTACCGGCTGATTGTTGGAAGTCG
ATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGACAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTACATCTTGCTC
CAGTTCCCGTCACTATAACGGGCGAACAAACCGCAAGGTTGTTCGTCGATGGCGTGTTCCGCTATCACGGTCTCCCGGAGACGATTGTCTCGGACCGAGA
CCCGCGGTTCACTGCCGCGTTTTGGAAAACGCTGTTATCTTTACTGGGAACTCGTCTGCAGATGTCCACTGCGGACCATCCGCAGACCGACGGCCAAACA
GAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCACCACGTACGTGGTCGACGCAGCTTCCAGTTGTTGAGTTTGCGCTCA
ACAACGCGGTGCACGCGTCCACGGGGTTCACGCTGTTCTACTTGAACGGCTTCCGCCACCCCAGAGTGCCTCTCACTCTTCGAGGAGACACTGACTCCTC
TATTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTGAGACCAGTTTCGCTGCGGAAACAGGTGGAATCCTTTATGGATACC
AAGCTGAACATTGTCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAAGATAAACAAAAGGAGTACTCAGACAAACAAGGAAGAGGAAACTTAAGTATAT
TTGAGGTTGGGGACTTAGTGTTGCTAGACACGAGGAACCTACCTCTAGACACTGTTAGCTCTGTCGGCAGCAACAAACTGAAGCACCGCTTCATCGGACC
TTTTGCAGTCCTGA