Description :
From Genome Similarity Track
Location :
Scaffold_2283:46- 1488
Transcript NameFunction/comments
Phymu_g14016folate-Biopterin Transporter (FBT) family

Sequence
1442 bases(100 bases per row)
CCTCCTTCTGACGAGGCAGGAAGAACAGGAAGACCCACGAGAAGGCCGTCATAGCGTACATGATGATCACAGCGTACGTGATATCCGTGCGAATAGACTT
GTCATCGGCTTGAATACGCTCCGTAGTCAGGTCGAACGGCTGGTCGATCACCAAGGTCATAGCGGTCGCGAAGGGCGTCGACAGGTTGGAAACCATCGTG
ATGAGGCCGTACACGACGCCTTCGTTGCCGATACCCGACAGCTCAACGATGACGAACGTCGAGATCATAAAACCGACGCCGTACGGGAGCTGTACCGCCA
CAGGCAGACCGAGCCAGAACCACTGGCTACGGAAGACATTCCAGACCGTAATGAACGTGGTGATACCGTCCACGACCATGACAAAGGCGCCCGTGAAGAG
AatcatccagcgccagttccagtgtAGCCCCCACTTGGACGTGACCATAATACCGGTTAAGAACAATACGTTACCGAAAATATCACTGAGCGTACTGTTG
ATCGGCGTGACGCCGACCATGTACGACTGCACGGGGGAGCTGGCGGTGTACGAGATACTGGAGAACATACcctggaagaagttgaagaagacgaccTGGT
ACATGACGCGCTTCTGGATCAGCTCCcagagctccttcatgtagTCGTTGAAGTTCATGCgaggcttcttctcctccttgatgAAGAACCACGTCATGGG
GATGACTGGGACCGTCAGGACAGCTAGAATGACCATCAATTGAGggaagctgatggagaagtcgaagtcgccgCCGTACTGGTCGccgttgaagcagaaa
ccGGTAAGGAGCTGACCCAAGATGACGAACACCGTACGCACAGCGTAGATGGCTGACTGGGTCCTGCCACGGGTCTCAAGTGGCTCGCGTTGAGCGAAAT
CCACCACGATACTATCGGCGCAGACGTCGGATAGCACGTACCCAACGGCAGCGAGGAACATGAGCATGACGTACTTGCCGGCCTGTGAAGACGCGTCGGA
GTTGATACGCGCCctgatctcgtccgtgtagTCCGCCGGTTTGATGTCGCGGTCGGAAGAAACCGTGTAGTACGGGTCGCCCTCGGGCATACACGCCATG
ATAAGCAGCGACAGGAGACAAATGAGCCAACCGATGACCAtccacggacgacgacggtaTCCCCATAGAGGAACACAGTCGGACAGGATACCGTagaagc
acttgaagctcCACGGGAGCACCACGAGTGTCGTTGCAGTCGTCACTTGAGTGCCAGAAGCATTGAGGAAGTTCTGCAGGAACGGGTAGATCGTAGCCGG
TAGAACGCCGTAGTTGAGaccgacagcagcgtacTGGACCAGTAGACCGAGACTGTCCTTGCTCTTGAGGTCTGGCGCGACACCTTCACGCAGAGCTCCT
CCCTCAATAGCGGTCGGGTCAGGCGTCTTCACCGTAGAGTAG