Description :
From Genome Similarity Track
Location :
Scaffold_4104:46- 1105
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_4104-fgenesh-gene-0.0ATP-binding Cassette (ABC) Superfamily

Sequence
1059 bases(100 bases per row)
CCAAGAAGGCGATCCTCAAGAACGTCACGGGCCGATGCGCTCCTGGAGAGCTCACGGCGGTCATGGGACCCTCGGGCTCGGGCAAGACCACACTACTTGA
CATCCTCGCGGACCGCATCAGCTCGGGCCAGGTCGACGGCGACATCAAGCTCAACGGTGAGAAGCGCAACGTGAAGACATTCCGCGCTGTGTCGAGCTAC
GTGGCCCAGGAAGACTCGCTCTTGGGCTCGTTCACGGTGCTCGAGACCTTGAAGATGGCGGCCAAGCTCAGCTTACCGAGCAGCGTCACCACCACCATGA
TCAACGAACGCGTGCAGACCGTGATCGACGAGATGGGCCTTCGTGTCTGCGAAAACACGCTCATTGGCGACATTTTCCGCAAGGGTATCTCGGGTGGCCA
GAAACGTCGTCTCAGCATCGCCATCGAGCTGCTCTCAGACCCATCGATCTTGCTCCTGGACGAACCGACCTCAGGCCTCGACTCGTCGTCGACCCACAAC
GTTATGAAGTTCATCGTACAGCTCTGCAACGAAGGCAAGACCGTGATCTGCACGATTCACCAGCCGTCCTCTCTGGTGTACGATATGTTCACCAACATCG
GGATCCTCAGTGCCGGCGAGACTGTGTACTTTGGACCGCGCACGGAGATCATTAACCACTTCTCGTCCGCCGGATACAGCTGCCCAATGTACTCGAACCC
AGCCGAGTACTTCATCAGCCTCGTGAACGCGGACTTCGAAGGTCACGCCGACATCCCGAAGCTCGTGAGCTCGTTCGCAGGCAGCTCGGTGTCGTCCAAG
GTCGTCAAGGCCATCACAGACGACCACAGTTCGGCGCACAATGCCAAGCCAGTCGAGCCTGCGCCGCCATCAGCATGGCGCCAGTTCATGGTGCTCATGT
ACCGCAACACGCTCAACAACATCCGCAACCCAGGCATCTACTGGGTGCGTCTGTTCATGTACTTCATGCTCTCGTTCATGGTCGGAACGATGTATCTGTC
GTCGAACGACGACATCTCGGACGAGGACCTCGTGCCGCTGCTCTTCTACGTGCAGGCGT