Description :
From Genome Similarity Track
Location :
contig_8:459983- 461430
Transcript NameFunction/comments
g2020.t1hypothetical protein

Sequence
1447 bases(100 bases per row)
TTAGCTAACATTGATCGTGGCAACGAGATCTATGTGGCCGCCTTCTGATGAGCGCGGTACCCACAGCACCAATGAGCCACCGCCCGACCCGGGAAGGCCA
AGGAGACCCGGACGCCACCGGTCGAAGTACATGGTCTTGTCCTGCAGCGCAGACACTGTCGAGTTCCACGTCACGGTCTCGCCGCTCTTGACCTTCACAG
AGTCGACGGTCTCACCGGCCGAGTGGATCTCCACAGTCACGTCCTCCGTGTCCGTGCTCTCGAACACAATGTTCACGGCGCCGTCACCAGCGTGTGTCCA
AGTACCGTAGCTGTCGGCGAATGCATCACCATCGGCAGCGAGTGCTAGAACGTCGGCAAGCGATCCGTCGTCGATTTCACCGATGAAAGACGTGGGCCCG
CACACCGGCTGAATGTACTCCTCGAGCATAGCAGCAATGCCCGTCGGATCGAACATTGCGATCACGTCCAGGCCCATGTCTGCCACCTTGAGGATGTAGT
CCGCAGTAGAAAGAGCGTTGCCGCCGCCGTCGTCGGAAGAGTCGACCAGGTTGTCCGTGATCAGACTCAACGCGGTCCTAATCTGGTCTCGTACAGTGTA
CGCGTCGCCCGTGATGTTTTGAATGCAGTTGTTGGTCACCGTAGGGATCTCGGTCAAGAAGAGCGCCGTGTCGCTCATCGCTAGACGGATCGCACTCACG
GTAGACGTAGCATCGGCCGTCTTGATGTCGGCAACAGCCTGCGTAACCTTCGTAATGATCGACTGCAGCTCCGTACCGCAGGTCTTGCCCTCCGAGATGA
GTTTCTCCAGTGTCGACGCGGCGTCCTCGTTCAGCGACTCTACGGAGCTACCGGCACCGACCGCACTAATGAAAGTCTTGAACGTGTCGACGCTGAGCAG
TGAGGACCCCTTCTCGACGACTTGGATGAGCACCTTGTCGACAATGCTCACGACCTCGGACGCCAGGTTGAGGTAGTCGGTCGGCACATCCAAGCCGAGA
CAGACACAGACGGCGGTGGGTAGGTCCTTGACGACAATGTCCGAGTTGTTCAGGAGCGAGATGATCTGCTCCTCCGTGCCGTTTGGGAAGCTGGTCTGCA
GCCTCTCGGCGTAGCCCACGATGTCGTCCACGACGGTGAAAAGTTTCTGTCCGCACTTGACGCCCTGCTGTACCGCAGCGCTGGCTGTGCTCAGCTGGCC
GACTCGCCAGAGGTAGCGGCGTTCAGCGCCACTTTAGCGACGGACTCGATCTTGTCGATGACCTCCAGCGCACAGTCATCGTTCTGGGGGATGCATTCCA
TGCCACACTGCACGGGGTAATTCAGCGGGCACTGGGCCCAGCACGTGGCGATGCTGTCGTACGCAAACCCAGCGGAGCACGTACTGGAGATGTATGTTTT
TCGGTAGCAGGCGTCGTCGGACGGGTCTACCGTGCCCACCCAGTTTG