Description :
From Genome Similarity Track
Location :
Scaffold_1:4597944- 4602086
Transcript NameFunction/comments
Physo_476233crinkler (CRN) domain-containing protein
Physo_350648protection of telomeres 1 protein
Physo_310526autophagy-related protein, putative

Sequence
4142 bases(100 bases per row)
GATGACCCGCAAGCTCTGATTCCCCTTGATACGGCCAATCTTGTCCAGAGCTTGCGCAAAGACGCCTCGGCTTCTTCCACTCCAGCGAATCCAACAACTT
CTCCCACTGCGCCTCTGGCGATTCCACAGTTGCGCCACCTCGCTGCGCCGGCGGCGGCACTACCACGATGAGTGCATCCTTCTTCGATGCACCAAGCGCG
CCGATCAGAGAGTCGACTTCCAGAGGCTCTCCATCCTTGTCCTCATACACTGCTCCGTTGGCGTAGACTCGCAGTTGATCCGCTATGATACCCTCTAGGA
TATCCGGATGATCATGACGATACTTCTGTCGAATCGCCTTGCGCAGGTCCTCTATATCACTGACACCGTCGGATGACACGGATGCTGCCTGGGTACCCGC
GTACGCGCCACGAGTTGTTGCGTCTGCCAGATGGAACCACACTTTTCGCGCCATCCTTTCCTCTTAACCACAACTGTCCAGTGAGTCTTAAGACTTCTGC
ACGTTTCGGTTCTTCTCTTGCCTTCTTGTGATGGCTGAGAACAAGCACGAAATAACCTCAGTTTGAGGTTAAATTCATACAATTCAATTCATTCGCAGTC
AATTCACTTGTCAATTCACAATAGAATGGAGCTGGTGGGCGGCCAATGCGTCGTTGATGGCACGGTGAAGCGCGCGTACCCGCTGCAACCGCTGCGCCAA
GCGACTGGTGGCGGCGCTACAGAGTCTGATGACGGAGAGCTGGGCACATTCGGTCCTGGTGTCGGCCCGTGCGGCCCGGACGCATTCCAGTTGGTGGCCG
TCCTAGTCGAGAATCATATCCTTTTGCAACACATACCACAATGTTTCTTATCAATACAAGTAGTGTAGAATTACTATACATTTCCCTTAACCTGCACTAC
TGTTGCTGATGAATACGCACGACATTCGAGACGTGTCTTGTGTTCTTTTACAACAAGTGGGCGACCAAGATGCAGTTCCTCAAACGCCACGCAAGTGCCA
CCCGCTCCGTTCTTTTCATTAAACCAGAAACTCTAACAATATTTGTTGTGGCTCTGCAGTACAAGATTCGCATTAGTGGACGCGGCCTCGTGGCGTTGGA
GTGGGAAGCTGGACCGGAGACAGAAGAGCGCGTGTCCTGTGCCGTCGTCGCGGAACGGGATATTTTGAAGAAGACATTGGAGAGGAAGCCTCGGCTGTTT
ACCTTTCCCCACAGTCTGAACGTGGAGGTGGCCTTTGAGGAGCCTCAGCGGCTTCCCCAATCGGACCAGTTGAAGTACCTGCCGTCCAAAACCATTTCTA
CGCGCGATCTGCACACAGGTTCGTATCAACATGTTGCCCTATAGGGTTGATCGTTTGAGTTCTAACGTGTTGGTGATGCAGCTAAACCGACGAGGCAGAC
ACAGATTCAAGTTCAGATACAGCCGAGAAAGGTAGATGAATAAGGGCTTGGAAGACAATACGATGATTGGTCGCTGGCCATTTACCTGCTGCCTCCATGC
TTCACAGAAACCGAACTACGGGAAGCGCACTCTAGGCGAAGCAAAGATTACTTCGCCAGCATACAGATATTCGTCTCTGGCTGAGTTGGTGGATGGATAC
GCCGATATCTACGGAGTCGTTGTCAATGTGACGCTCCCCAAGAAGACGAGTGGACGGGATTTCTGCGTTAGTTCGCTGTTTCTTTTGCTACCATGAGCAC
CGAGTACAAGACTGACAGGGGGTTGTGTATATATCTTATAGATGACTGTGAGTGTGACGGATGAGAGCTGTCCTACGCGCGCTGAAGCAATCCAGATCAA
TATTTTCTACCCAACGATCGCTCAAATGCCGAAGATCAAGGTACGATGAGCATATGATTGAAGTTTTTGAATACTTGAAGTGGTTAATGATCGCTTCTGT
GTTATGCTGGCAGTATGTGGGTGATATAGTTCGCTTTCACAAGGTGAAGATTCAGCAATACCAGGATAGAATCCAAGGCCTCAGTCTGTAAGTTTTTCTT
TTTGTCGGTGAACTAGCCTTGACCTCAAGACTAACATGCTCATATTGACAGACCACGAGGCACACGACATCTCGTTATCCGAGAGCAAACCGACGGTAAG
CTGGAGCAGCTTACATGCTCTGACAACTGGACTTTCGAGCCTTCCGACGAGCAGCGCGTTCGCCACCTCATGTAAGCGTGTTGTACTTCCATTGTCTTCA
TGGATAAAATACTTACGGTTCATTCTTGGCTGAAATAAGTAAATGGGCGCAGAAAAGCTTAGCTGAGGACGCTACTTTACCGCAGGGCTGGGCTGTAGCG
CCCAAGCTCCTGGCCGAATTGAGCCAGGCCGAAAACTTTATCGACCTCGTCGTGCGCGTCCTGTACCTGGACGACTCTGAGGAGCCCACTCGGTTGATTG
TTTGGGACGGTTCTGGAAGTACAGCCGATTCAGATCCGACACTCGTTCGCGTATTGACAGATCACGGGATTCCAATTCCACCCAATGGAATGCTGAAGGA
AGTGATCATGTCGTCCTGCTGGAGCGTCGTGAGCGATATGGGCTTCGTCGATGGAATACTCGAACACTGGTGCCGATTCCGCAATTTGGCAGTGGGGACT
GACGAGGCTGTTCCCGGGGCTGCCAATGCACCTGGAGGGAGGGAAATCCTACGCTTCAGAGAAGTAACATCTCTCATGCTGATGGCCAACTTCACAATTG
ACGTGAAGCATCGTCTTTCGTTGATGAATGAACCGAACCCAGCAGGTACCGCGACAGGCAGCGTTGAAGGAGGCCAAACTGGTGTTGACCAAGACCAAAA
CCCTGCTGCCGCTAACCAAGTCGAAGTTGCTACGGTAATCCCGGAGCACATCAAGGTGAAAGTCCCAGTGACCCCGTTACAAGAAATCCTCCGTTCCCCC
AAGACACCACGCAAGTTCCATTGTTGCGCCCGGGTGCGCGGCATTTGGCCAACTGATATCGAGAAAATCTGCAAGCCCAAGCCTGGCAGTCAAAACGAGT
ACATCTACTCGTTCGCCCTGACTGTAGAAGATAAAGCGGAGTCCCTGAATATCATCGTATACGGCAAGGATGCGGTAAGTGCCCAACAAAGGTTCTCGCT
TGCGATCCAAGTGTCTGACTCTGGATGCACTTCATTGCAGGAACACTTTCTTCACGGGATTCCTCCCTGCGATCTCACCAAAAGCACCAGCTCCAAGTCT
CTCCTGGAGAAGCGGTTTACAGCGCTGATGCGAACCCCTGAGGCTCTGCACTGGTGTATCAAGTCCTACTCAGTGTCGTTACCTCCTACTCGCGATGGTC
CTGCCACAACCGTTCGGTACCGTTTGTTTGATACACGGCTGCAGACCTCGTAGGCTCGGCTTGTCTAAGTTGGGGGTGGCCAAGGTGTAGGCAAACATGT
TTCTTCCTGTTATGAACGTCATCGAATGCAGCAACGACACGTATATATTTTTACCGTTAATCTTGCTGAGAGTCTTCACTTCACGGAGAGCCCAGACTTG
AGATGGAAATGCTGTCCGCAGGGTTTCCTTTCATACCCTCTAGATCCAGCTCGCCCAACCGGCCTTGTTGGTGGAGCTGAACAGCACAAGCACCGCACCA
GAAATGACAACAAAAGTTAGCTTCAACAACGCATTGAATATCATACAGCACCGTCAACGAAGACCCACCTTCTCCAGCCAGTAAAACTCATTGTCCTGAG
GCATGTACCCGCTCATGCGTCCGCCGCCCATCGCGTTCTGGATAGCCTGGGACTGCATAAGCTGCTGCGACATCGACATGCTGTACATCATGGTGTCGCC
CATGCGCATCGACTTCTCCATCTCTTCCTCCTTGAGCTTGCCCAGACGCTGCATCAGCGCTTCTCCCTCACGCGCACCAACCCACTTGGGGTGATTCTGC
TTGAAGTTGATGAACGAACTCTCCATCTTGGCGTCGTTGCCGTACTCCTTGAAGTCAAACTCGGCTAAACGGCACACCGCCCCGGTGCTCGGGTGCACGA
GGGAGTGCGAGCGCAGGAAGAGCAGGATCTCGCGCGAAAGTCGAGGGAGCGACACACACAAGATGTACGGCGCCAGCAATACCGACACACATTCCTCCGC
GAAGAGCACAGCCTTGTAGGGGAACAGCACTGTGAACGCATC