Description :
From Genome Similarity Track
Location :
Scaffold_996:4597- 11711
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_996-fgenesh-gene-0.1Rap guanine nucleotide exchange factor (GEF) 4
Pytir_DAOMBR486maker-pir_contig_996-snap-gene-0.6Senescence-associated

Sequence
7114 bases(100 bases per row)
AGACCCCGCTGCTGCCGAGCGTCGAGTTGAGCCGCGCTTTCATGATTGAGCCAAACTTTTTCATCTGCCGGTATTTCCCCAGTGCGTGCGCACCGCCACC
ACCACCTCTCAAGCCCACCGCCGCTGCGTTCGAGCTCTCGAGGTACTCGTGCAGCGTCGAGAGCTTCTCGTCGAGCGTGAGTAGCGGCTTGGGCGTGAAC
CCCATGGCCTCTTGCTCGCGGCGATCTTTGTCCATGGTCACCTTTTGCCCCAGGCGTGAGCAGATGAATTGATGCAGGCGGTGTGCTTTCTCGCGCTCGA
CTTGCCACTCTGGCACTAGATCACTGCTGCTGTTGCTACTTAGGTTTGATAAAGGCGAACTGGCGGTATTGATACGAAGCCCCAGACTTCCGGCGCCAGA
AAAAGTACCTTTGCTGCTGATCCCTCCATGTGCGCGCGGTGTTTTGCTGCTATTGTTGTTGCTATTGCGGTTCGGCGAGACCACCGCAGATTGAGAGGAC
ATGCGCTTCTCGCGCCGGTCCGGCTCCACCTGGATGCACCAGTTGTACGCGTCCTCAAAGTGCACAAGCTCGCCCGCCGGCAAAATGCACAGCAACGCAT
TGCGAAAGTGCTGCGGCGTCATCGTGAGCGCCGCGTCCATCGCCTGCATCTCGGACGCGAAGAGCTGGTGCACGCAAAGAAACGGCTCGTCGCAGACCGA
GTTCTCGACCTCGTGCTTGGACAGAATCATGCTCACGACCGCGAAAAACCGAGGAGTAGCCGCTGGTTCCGCTAGAGCAGGGGTCGAATCAGCGAGCGGA
TCGTCTGGCGGTTTTGATTTCTCGTCGGAAGTTCCNNNNNNNNNNNNNNNNNNNNNNNAGCGCTTGATAGTAGTGAACTTTGGGTCGTCTTTTCAGCAGC
CTCCTGCGCACTCGCAACAAGCTCTCGCTGCTCTGCTGCTGTAAACACGATCTTTTGAAACGAAGAGAAAAGATCCGGCGCTTCTGCTGGACATGCTGGC
GCAGCTTGGAATGACGGCGGCGCTGTGGAAATTACGCGCTCTGGAAAGTTGGAAAATGCGCTGTAGAGTGATGATGGCACACTCGGCCTTTTTCCCTGGG
AATGGCGGGAACTAACTGCGGAGGCGGCGGATCCTGGAGGTGACATTGCCGTCGCAGACCGAGCAAACTTTTCCCACAAGTCTCGCTGCAGCTGCTCTTC
CGTGGCTTTCGCGGGGCGATCTCGTGTGCGCGGCACTATTGCGTACTTCTTCTTGGGCATGATGTAGTACGCAGGTCCGCTATGCTCGTCAAATTTACTT
GTAGGGCCGTGCGAAGCGATTGCATCCTTAGTTTGAGCCTGAAGCGCAATCTCCCTTGCCTGCGTGGGCGAACTCACAGCTTGAAGAACCCGCACAAGCG
GCGACTGCATCGAGCGCACATTTCTTCTGTCGTCTTCTAGCTCGGCCTCGCCATTGTTGAAAGGCATTTTGACACTGATGACAACAAAGTCACCGTCACA
AAGCTGCTCTGCTTGCTCTTTCAGCGCCAAAGAAGTCTTTCGAGAGTCTGGCAGCAGCTCATTGTCACCCCTGCCGCCGTTGNNNNNNNNNNNNNNNNNN
NNNNNNGCCTGCGATAGCTGGTATTACTTCTGTGGAACGGATCATCATCTGGACGCGCTGGCCGTGAAAAGATAAAGTTCTCGTGTCCAAACTGGTTCAT
CACTGTAGTGGCAACTTTATCGACGAGCGCTGTTCGTGTTACCATTGGTGACGACGGCAGCGGCGAGTCGAATGAAGAGACAAAAGAACTTGCACTTGCC
GGTGATGGCGATGAGTTCATGCCACCACCGTTACTGCCATTGAGTGTCGCAGCCCCGATAAGCAGGGTGCGCCGTGTACTTGCAGCTCGCCCGCGTGCCT
CGGCGTGGTGCTTCTTCTCTTGCTGCTTGATCTCCTGCAAATCAAAATACACCAGCGGATTGCCTTCATTCAGCGCTTCCACTTGACGTCGCCTCTCCGC
GACGAGCACATCCTCAAGCTGCTTCTTTCTCGCGACGCTCGGTGGCGCATCCGCGTTGAAAGTCGACACAAAATGGCCGATTGTGTGTGTCGTAGATGAC
GAGGTTTTCCCTACAACTTGCTCGTGCGGAGTAAGAAGGATGAACTCGTTTGCATCCACGAGTACACCTTTTTGAGTGACCAACGTGTTGATATCCTCCT
GCGTTTCTGAAACTCCTAGTAGATGGTGGTGGACCTCTGCCTGGTTTCCATCGGCTGGAAAAGAAGTCGAAATGGCCAAAACAGATCCATCGGGTGGATC
TGCAACGGCAGGTTCCTCGTTCTTCTTCATCTTCCTAGCAGTAGCCTTTTTCTTCTTCCTATCGTCAGCGGCGTTACTGGTTGCACTCCGTGATGTCTTA
GGAAGAATCTTCGCAAGGCGCTCACGGTTCATGTACTCACGCAACACCTTCTGCTTGTATGCTCCCCATTTCTCGGTCTTGTGAAAACGGTCCAGGTACA
CGACGCTCTCCGAATGCGAGCGCGCAGCCGAGCGAAGTGCTTCCCGCGCAGCACGAGAGAGCCGATGGAACACGTCGTACTTGGACAGGATCAGCACCTC
TACGGGCGTGCTCGCTGTGACCGTTACTTCGCGAAAGATGATCTCGTTGAAAGTTGTTCCCGCCGCTCTGCGGGTCATGCACATAGTCACAGTAGCAAGA
GTGAGTTCGTGTATCTTATAGCCATGGCATCGGACAGTCCAAACTCACAGAGAGTCAACAAGTAAACGTACGCATCATCGCCCACGACTCGATATCGGCC
GATGCGCTCCACGAACGCAGCGTGGGTCACTTGGGTCCCAGGATCCACGATCTCCTTGGTCATGATGAGCTCTCCGCGAACAATAAAGAAGACCTGTAGC
GCTTTGTCGCCCTGTTGGAAAAGAACACTCCCTACAGGGAGCTTCTGCTCTGAAAGCACATACGACATCTCCTTGAGCAGCTCGCCCGTCCACTCAGGCG
TCTGGAAGATCGGGATATGGTCCAGCACCCCCACGCGCTTCGAGAGGTCCTCTTTCTGCATCCGGCGTAACGTCGAGTTGTAGTCTTTCTCGCAGATCAC
GAGGAACTTGCACTCCTCGCGCGTCATCACGGTCGCACTGCGAATGCCGTGCCCTTTCATCAGCGCCAGCTCTCCAAAGTGCGAGCCTTCTGTCAGGTTG
ATCAACTTTGTTTGCTGCGCGTTGCCGCGAAAATCCTTGGAGCTCACGATCACGTCCACGGATCCAGTGAAGATGATGTAGAATAGATCGCCCACCTCAC
CTTCTTTGAACACTGGCGAGCCTGCGGGGAGCTTAAGAAAATCCACGACCGTGCAAAGCTCACGCACAAAGGTTTTTGGCAGCGCACGGAAGAATTTGAG
CGTCTGCAGGTACTCGCTCAGCATATCGATGTCCGTCTTCGTGCGCGCGTTCTTCTTCTTCGTCAGCACTTTGATGTACTCGCGCTGCGACTGTTGCACG
GACTTGGGGATCACCATGCCGTTCGCCATCTGCATACGTGAAAGGAACTCCATCTGGTCTTTCTTGAGCATGATGTTGTAGTCCTTGCGCGAGATGCGCA
CGAGATCTGTCGTGGTCTTCGCAATTACTGTCGCCGCACGAACGTCGTTGTTCAGCAGTGAGCGTTCACCAAAGTAGTCGCCCTTGGACAGCTCGCAGAC
CGTGACCTCAACTTTCTCGCCGAGGACGCGCTGGCTCACGCGCACTTCGACCACACCCGAGAACACGAGGTAGAGCGCGTCACCTTCGTCGCCCTGACGA
AACATGACCTCTTTCGGATGGAAAGATGCGAGTGTCATGCGTCGACAAAGCAGATCGAGCTCTGCGGGCTGCAACCTCTCAAAATCTGTCGTGATCTTGA
GTTTCGTCATCTGGAACCACGCCTTGAGCGCCTGAAGATCCATTTGCGAGCGGTTCTCGCCGTTCTGCGCAAACGCACGCCGACAGGACTCCTCCAGCAA
GAGCGTGCGCCCGTACATTTTCTTGGTTCTCGACTCGCGCAAATCAAAGCCGGATTTGATTCCTAGACTCTCGTCGTCGTCCTCGTCGTTGTCATCGTGC
TCGTCGTCGTCGAAATCCGTCTGGTTGCGCAACATCGATGTCTTGACCCAGTGCTCCATGACTGCGGAGCGCGCCTCTGATGGTGGCTGCTGCCCAGTGC
TCTTGGACCATTTGTTCGCGACAGCTGCCTGCTTCACGAGGTTCTTGACTCCATGGCTCTTGAGGACGTGCGCCAGTGAGATGCGTGAGGACTGCGACTC
GCTCGATTGTTGTGGTCGAGAAACAGTTGTTGCCTGAGACGTTGCACCAATCTCCTTGGCAACTTTCTGCAGCACCGCCGACCACGGGTCGTGCACCACT
AGGTTCGCTGGCCTCACTTCGCCTCCACTCCCCATAACTCCCTCTTTTGGCGTTGATGAAGGCTGTTGTTGCTCTTGTTGTCGCTGTGAGATCACCGAGC
GCGCTGCAGAATTGAACAGCGCAACTTTCTTTGCAGATAGTGGCGCTCCTGCTGTTGTCCCAGAATCTGCTGTAGTTGGCAGTTCCATTGCAGCAGATGA
AGCTAAAGCTGCCGACTCTTCTCCAATAGCTGGTTGCGCTGGCACTATGATGCTCGACCGCACGATGGTTGTCATTTTGCTGAGTCTTTGCCGCGCTGGA
CCTACATTATCACCCGAGCCTTGGGTTACGGCCGTAGATCGTGCCTCGTGATGGAGGTTCATCATCGGGAGAACTTCGCTCTTGCGGCGGCGAGCCATGA
GCGCATTCATTGTGTGGTGTGTTGTGCAACTGTTCTAAATAAATGGTGCCGGGCACGCACACAGAGCACACGTCACTGCAGATGTGACTCGCAATGACAG
ACCGAGATGCGCAAGCCTCTCGCACTTCTCGGTCTTTTGTTGCAGCCATTAATAGCGAGAAACAGCACAAGCATCCTAAAAGTGGACATTGCTGAGCAGT
ATAAGCGATTTTGACTTCACTGGGCACGAGAAGTCGATCAAATTGATACTGGATACACAACACATGAACGTTATGGAGCAAATGGTTGGGGACAGTAACA
ACTCACACACGCTAACAAAACACAATTTGCATTACGATACCAGTTTTCATTGTTCCCTATTGTTCGCGTTCTCGCTGGGAGGAAACGGATGGATGCTATA
AAGACTGTTAGTGCACGTGCTTGCAGGTCTTGCAGTTCTTGTTCCACACTTGGTGTGTGTGCGCGACAAACATTGGGCAATTGCAGAGACGACATGGACC
CATGATCGACGAGCGTCTCATGGCTTCGTTCTTGTGATCTTCAACTCCCTGCATCGCCATGTCAATCGCTTCGTAGAGCGGCCGCGCAGCAGCTGGCTGT
TCCACGTAGCCACTAAGGATCTCGCCAGGTGAGAGATCGCGTCCGTAGAATTTGCGGTTCAAGTCAGATCGCGCCGCGATCACCGCACCTTGGAGGGAGA
TTCCTGCATACAACCCCTTGCTTTGCGAGTAACTGTAGTTTGCGTTCAAGCCACTGGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAGCGGCGGCGAG
AGCGGAGCGTCCGTATGGACCAACTGTGACGTCCAAGCCAGCACCGAGGTTGACCTGTGGTTTGTGGAACACCTTCACCGCGCCTTCTGAGCCCAGAATG
ATCATCACCTCGACGATTTCTCCACCGATTTCAAACCCGCCTCCGAGACCGATCGTGCCAATAGCAGACGGGGCTGACCACGAGCCATCGGGTAACTTCG
CGACCACCAGACCCGTTCCAATCTTTCCCGTCACGAGGAACCCAGCCTTGATAATCGTCATAATCGCCAGACCATGTGCTTTCTGCAGGAACGCGACTGG
AATGGAGCGATCTGTCGATGAGCCCCAGCTGTCACGGAAAAAATTGCCGATAATGTCGGCTGCGTTGTTGCACTCTTTCATGAGTGAGTTACTGAACGGG
ACGTGGATCGCTCCTTTCGACTGGTGCATGTTCTCCTCTTTCGATTGTGCATACTGAGCAACGAGCTCATCTTGGTACTGGTGTAATTGTGGCGCACACT
GGATGCAGACGCGTTGCGGGACACTCGGTTCGTACTTCTTTGCATTTTCAATCACCATTTCAGGAGGAATCAGCAGTCGAACTGGCGTGCACGAGTTGCA
CACGTTGAGTCCACAGCGTCGGCTGGTTTGATTACACACACAAAGAAATGGGACGTTAGATTCATGAACGAGATTCAGAGTCACAAAACGCCACGCGCCT
CATTTCATTCATAGCTGGGCGTACCATTGATGACGGCGCTTCGTCACATCAAAGCCCACATTGCAGATATCACAGTTCGGGTGGTCTGCGTATCGGTTCT
TCAGAATCCCTTTGCTCTTCCCAGCACCGCCGCTAGCGAACGAGCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTTGAGTCGCTCGAAGAAG
AAGAATCTCTACCGGCACTACGATCAGCAAAGAGAGCGTCGCATCATGAATGTTAGTTTACCACCAATCACACCGTACAAAATAGCAGATGAGAAGCATA
CGCGACATGAGCCATACCTGCCCAAATACGGTGCTGGCTGGCCATTCGCACCGCTGCTGAACGCCGACACACGCTGTTGGCGCGAGTTATATTCGATGAG
GTCCTTTCTCAGCATGTCGTCCGGGATCAAGCGCGACAGGTGTGGTACAAAGTTGCGAGTGTCGTTCAATCCCAACTCCGCGACAAGACTGTCGTAAAAT
GTCTTCACGTCGATCTGCTTCAGTCCAAACGCCTTGCAGTTCTGCTTGAACGCCTTCACGCCCGTTTCGTTGCCGCCTCCACGCGCCGCACGGATCGTCT
GCACGCAGCTCTCGTAGACTTCTTGCGCTTCAGCACCCGTCGCTGCAGGAGGAACTGGTTCGGCTGGTGCCTGACCCGCAGCTTGACTCTCGTAGCCACC
GCCGTTGAAGCTGTTGTTGTTGAAACTCTTGTTGCTGTTGCTGAAGCTGCTGCGGAACGCTGGTGGGTTGCCGTTGTTGTTGCCATTTCCACCGTTGAAG
CTGCCGTTGAAGCT