Description :
From Genome Similarity Track
Location :
contig_15:459628- 460634
Sequence
1006 bases(100 bases per row)
CCGTGTCAAACGTTACTGATCTAGCAACCATGAACTTGTTGTTGTGTATATCCAGCAGCCTAAACCCTTTGGTATCTTCAGAGATACCGAGGAATCTGCA
CTTGATTGCTCGCGCTGCCAGCTTCTTGTCCTTTCGGACAGCTGCAGGCACGTAGGCAAAGCACACGCAACCCCATACCTGGAGTGTCTTTTTGTCCGGG
TGTGCCCCTTTTACTAATCCATACGGTGTCCTGTTCTTTAGGCGACTCATGGTGGTGCAGTTTTGCCTCTGGCCACCATTTGGCTGCCATGTTTGCATCC
CGGAGGGCACAGCGTACTTTTCCCATCTTAGATTGATGGTCTCTCTCTGCCGCTCCATTTTCTTCTGGACTATATGGATTAGAGGTCTGAAACGTTATTC
CTTTTCCTGTGCAGAATGTTTTAGCGCTGAATTTACAAATTCCGTGCCGCCATCTGATCTGATGCGCCTTATTGTAAACTTTCCCTCTCTTTCTAGTCGT
GTCAGTAGCTCTTTGACTTTTATCTGTACCTCCGTTTTCTTTCGAAGTACATATGTCCAACGCCATGATGTCTGATCATCAATGATACTGAGAAAGTATC
TGATAGAGCCTACTGCACCGTACACTCCCAGCGTCTTCATGGGTCCATTAGTATCCATATGAATAGTACTAATGGGCTGGTTGTCTCTAGTGCCAACCAT
ATTCCTGTAGCTCATCCTGCGCATTTTCATTTCTGTGCATGTGTGGCAGAAGAATGGTATCTTCGTGAGTGCCACCCTACTAAAGCTAGGTAGACCTGGT
ATCAGATTACCACTCATCACCTCAATTAACTTATCCCTGTTGAGGTGTCCTAATTTTACATGCCACTCCATGAAGGCTGCTTTGACCTGAGTGTGCCCTG
CCATCCTAAGGGGCATGATAGGCCTTGCTTTTACAGCAGAGCAGTAAATCTGCCTGTCTCTCAGTGTACGAGCCTGTATATAGTAGGCTCCATTGGCTGC
AATAGC