Description :
From Genome Similarity Track
Location :
scaffold_12:45951- 48818
Transcript NameFunction/comments
g750.t1 hypothetical protein PHYSODRAFT_552333

Sequence
2867 bases(100 bases per row)
TGCTCCAACCTCATGATTACGAGCAAGTACACGTACTACAACTTCCTGTTCGTGTTCCTCAAGATGCAATTCAGTCGACTGGCGAATTTCTACACGACCA
TTGTGGTGGCGCTCTGTTTCTTCGACTTCTCGCCTGTGAGTCCCGTGGCCAGTCTGACGCCGCTGCTGATCGTGTTCGCGACCTCGGCGCTGAAGGATGT
GAGCGAGGATCTTCGCCGACAGAAGGGAGACGCTTTGGTGAATTCTAGGGCGGCGCACATTGTTCGTCGCGATGTATTGGACGAAGTGATGCACATCGAT
GGCACATGGCAGGATATTGAAGTGGGAGATGTGCTGCTACTGAAGGACGGCGATCAGGTTCCTGCGGATTGTGTTCTACTGGCCACTAGCAGACCGGATG
GAAGATGCTACGTGGAGACGGCCAACCTTGATGGCGAAACGAATCTCAAGATCCGACAGGTAGCGAGCTGCACGAAGCATTTCTTGACTGCTGAGGAAAT
CTTGGACCGGCATAAGCTCGAAGTAGAGTGTGACGTGCCCAACAAGGACCTCTTCTACTTCGACGGTGTTTTAAGGCTGGGAAAACTCACAGACGAAGCT
GTCACAGATGCCGACAAGGAAGACAACGAGACCAGTTTGACCATGGACAATTTGATTCTACGTGGAAGTGAAAGCCGTAACGCCGAGTGGACGCTTGGGC
TTGTGATCTACACGGGCAAGCAAACGAAGGTCCAAATGAACTCTGTTGCTGTGCCGCTGAAACGTAGCTTTGTGGAGAAGACCTTGGACACCATGTTCGT
GCTGGTTCTGATGCTGCTTTTCGGAATTTCGATCGCCTGCACGCTAGGCAACAACAACTGGAACTTGGATCTGGCGGATGAGACGACGCCGTGGTACATC
CAGGAAGACTCGAACGGCTATATTTTCTTGAGTTACGTGATCTTGTTCAACAACCTCATCCCGCTCTCGATGTACGTGACGATGGAAGGCGTTCGGTTTG
TTCACGCGCGTTACATCGAAAACGATTTGGAAATGTACGACTCTAAGACAGACACTCCGGCACAGGTTCGCAACAGCAATATCAACGAAGACCTCGGACA
GATTCAGTACATTTTCTCGGACAAGACAGGTACTCTCACGTGCAATGAGATGATCTTTGCGAAGTGCACCATTGGGGGCCTCAGGTACAATGATATTGAA
GTGGACCCTGCGAAACCTGGACGACCAGGCACACGGTTTAATGATGGGCGATTGCTGGCGCGACTGAACTCGAATCACTCAACGAAGAAGGAGATTCATG
ACTTCTTGCTGCTACTTACGATTTGCAACACGGTGATCCCGGAGAACAACGTTCCAACGTCGCCGACATCCAGCAGCGACTCCTGCTCAGCTCCGACCTC
GACGATCAAGTACAACGCGTCTTCCCCTGATGAGGAGGCTCTTGTGCTGGCTGCTGCTGACCTAGGCTATGTTCTTGAGTCCCGTGATGGTCCAATGTGC
AACACGCTTATCCAGGGAAGGCCCATGTCGTTTGAGATCCTGAATGTACTGGAGTTTAACAGCGACAGGAAGCGTATGTCGGTTATTGTGCGATTCCCTG
ACGGGAGTATCGTGCTCTACTGTAAGGGCGCCGACGACATCATTTTCGACTTGCTGTCAAAGTCCCAGCCTCAAGGTGTAGCTCACGTGACTCGTGGTCA
TCTCCAGGAGTATGCATCCGAAGGTCTTCGAACTTTGACGACTGCTATGCGGCGCCTTACTCAGGAGGAATATGACCAGTGGAACCAACTGTACCGACAG
GCAGAGTTTTCCATGGAGGGGCGAGCCGCCAAGATTGCTAAGGTTTCAGCCATTGTTGAGGTCGAGTTGACTTTGCTCGGTGCGACAGCCATCGAGGACC
GACTGCAAGACGGCGTGGAGGAATCCATCTGTGCCCTACGCAAGGCTGGTATTAAGTTCTGGGTGCTCACTGGTGACAAGAAGGAAACCGCGCTCAGTAT
CGGCATGTCATCGCATGTGATCGATGATAATATGGATGTGATCGTCTTAGGTCAACGCGACAAGGGTTCTCTGCGTACAAGACTGGAGGAGTTGTACGTC
GACCTTGTAGAGGACAAGTGGGGGTCAGACGAAACGTCTTCAGCAGTCAGTGTGCTGTGGGAAGCTTTGAAGCGAGCCATTTTGTACCTATGGGATCTCG
TGAAACTTGCGCTGGTCGGCCGAGACGAAGAAGCAGAAGCACGCAAAAAGCGGAGGCGCTTGCCAAGACGTGAACATGCTGGGGCTGAAACACCGACCGA
TAGTCCTGCTCACTATGACGAGGTGTATCCCGCCCTACCAAACCGTGACATTACTGAGAACAGCTTCGACCGAGATTTGTGTGACCATGACTTCGAGCCG
AAGACTGACAATATGACGGGTGGCACGGGAAGTATGAGCAGTGGCGATTACGTGGACGAGGAGCTGGAGTTTGCCATGGTGATCGACGGCAAAACGCTCG
CGCTAGTGCTGGATGACGATATCAAGTATCTCTTCTTGGCGGTGGCTACGCAATGTAAATCGGTCATTTGCTGTCGCTGTTCCCCATCCCAGAAGGCGTC
AGTGGTCAAACTAGTTACGGAACCCACGCTCATGTTCTCACCAGGCAACATTACACTAGCCATTGGCGACGGCGCCAACGATGTGCCTATGATTCAGGCC
GCCAACGTTGGTGTCGGCATCAGCGGCAAAGAAGGTCGTCAGGCTGTTCTCTCCAGTGACTACTCCATCGCAGAGTTCCAGTACTTGAAGCGTCTGTTGT
TGGTGCACGGCAACTACAGTTACAAGCGTATTTCCAAGCTCATCCTGTTCTCGTTCATGAAGAACGT