Description :
From Genome Similarity Track
Location :
Scaffold_110:45951- 48188
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_110-fgenesh-gene-0.6Conserved gene of unknown function
Pytir_DAOMBR486fgenesh-pir_contig_110-abinit-gene-0.82Transducin family protein

Sequence
2237 bases(100 bases per row)
TGGTGCAGCAGTGCTTTGGCTGCCGCTGGTTCTTCCAGTCGCTCAACGGGTTCGACTTCCCGCGGCGCCACATGCTGCACTCGCAGAGCCCCGAGGTGGT
GCGCCAACGCAGGAGCAGTCTCGACCAGTTTGCGCGCCTGCTCGCATCGCACACGTTCTCGGCGATCCCCAAGTGCGTCTCGTGCAGCAAACTGCCGTTC
GCGCGCGTGCGGGACTTCTTCCTGAAGGACGCGACAATCTCGCCGCTGCTGAGCTTCAAGATCATCTACAACGCGCTCGCGCCGGAGAATTTCTCGGCAA
TTGCGGATCCGAAGAAGAGCAAGATCGAGTTTCGCCGCGGCCACGGGATCGTCAAGATGCTGCAGGTCGAGAAGCCCGTGCACTCAAAGCGCGCGAGCCA
GGAGAAGGCGTTCCGGAAGCAAGTCAAGCACGACCAACAGAGAGCGATGCAGCAGCAACGGAAGATGTCATCCAACCAGCCAGGATACCGCGTGCCGACC
CAGCAACAGCCTATGAATACCACAAAGGAAGACGGCGATGAGGAGGAACATGAAACGACGACCATAGTCCACATTGAAGAGATCCATGCGAGCGACAACG
ACAGCAATGATGGCGAAGGCCTCGACTTTGTAGGAGACGACGAGCTGGACATGACGGGCGTGGAGATCGACATCTCGATGGACTCAAGCGCGCGCCGCCT
CGCGCCGCTGCGCAAGCAGTCGATGCAGAACCTGTGGCAGCCCTGGGAGTTCGCGCCTCCTGCAAAGGCCAAATCGTAAGAGGCTCGATCTGTTGTGCAC
ACCCTACAAGAATGAGGCTGTATTTTGAATGACTGCGGCATGAATTCATTGTCATATTTATTATCCTGAGAGTCTGGGTTCTTTCCGTGTCCCATTTGCA
CTCATGGCTGCACTTTCAAACGAGTCAGACAACCTACCCTCTCTCTATGCATATGCAAGTAAAGAGGCCATGAGATTGAGGCAACCACTTCATCAGTCAA
AGTCGGAGCAAGCAGCAAACTGAGTCTTCTCGATGGCATTGAGCGATTGATTGACCATGTAGTGAGGTAGCTTGTCTATTGGAGCGTGCCTTCAAAGGCT
CGCTTTCCTTCTTGTCTATTAAAGTCTCACCCAGCCAAAATCGGTTGGTTGGAGGAGAAAATCCGTCTCATTTCGTTCGACTACGAACAGAAGAAAATCG
GGTTTCTACTTGCAGAAGCGGATAGTTTGGAGCCCCTGACCGACCACCACGACCACCTGCGCTCCACTGGCATCGCTAATGCTGCTGCTGCTGTCCATTT
CCTCCCAGACAGCAATGTCCGCAATGTCGGCACACTCGGAGAACGCCGCGCACTGCCACTGGAGTGATTTCTTCCAACTCTTCCTGTCTTCAGGTCCATC
ATTCGAAACAACCGCCCACTTGCTCACGCGTTGGTCGTAGCCTGCGATGAACACCACGTTGCCGTCCGAGAAGATCGTCTTGATTGCCGAGCCACTTGCG
TTAATCGCGCACGTGTCGCTCACAACACTGTTGTCGTCATCACCATTCTCTCCTTTCAGCAGCGACTTGATCTTGAACTCGCGCAGACGCACGTTCTGGT
CGTCGCCGCCGCTGATGATCGAGAACAACTCGATGTCGTTGTGCTGGTGCTGGTGCGCGATCGTGAGGCAGTTGACGCCCATGTCGTGCGCCAAGTACGA
CGCTCTTGGTGTCAAGTCGGCCAATTTGGCGCTGGTCTGGAATTGCTGCGGGTCCAATACATCAAGCTCCAGACCAGCAAGGTCTCGCACGATCCCGCCA
AAGTCCCAGATGTTAACCATGCCGTCCGTCGAACCCACAGCCAATACCGCGACATCGCCGCTACCACCGAATCGCTGGAGACCCGCACAGGTGAGAATGG
GCTTCTTGGACGAGCTTACCTCGCCCAGTTCCATAAGCTTTCCCTCTACAATGTCAAGGAGCAGCAACTGGATCGAGCCCTCCGAGTTGCACGCCGTCAC
GAGGCGGTAGCGCCCATCATCGCCTTGAGCGTTTGGTCGGATCGCAAAGGTCTCAAGCCCGAGAATGCGATGGTCCTGGAGCGAGTCCTCCTTCTCAAAG
CCGCATACGTGCTCGATCACGTCCACTTGGTCCGCCACTTTCCATACGTTGATGCGCTGCTTGCCGCCGCCAGAGAGCAGAAAATGTGCGCTGTGGACTC
GAAACGAGGTCATCGCACGCACCGTGGTCGTATGGGC