Description :
From Genome Similarity Track
Location :
contig_15:459410- 460416
Transcript NameFunction/comments
g4065.t1XP_002904846.1 conserved hypothetical protein [Phytophthora infestans T30-4

Sequence
1006 bases(100 bases per row)
TCCAGTTAGCTCCTTTGCTTTGCGTTTGAACCCCACTACTCCAAGCAATTCTGCTGGATTTGGTGTTGCACTCGATGCATCTTGTGCTACTACCTCGCTG
GTTGGTGCCTTTTCCAGAGAGTCAACGTCTATAAGCTCATCCGGTGTCAGTTTCTCCGGTTCTTTTCCAAACGACCGTGTAATTATGTTTGAGCAGTTTT
CCGTGTCAAACGTTACTGATCTAGCAACCATGAACTTGTTGTTGTGTATATCCAGCAGCCTAAACCCTTTGGTATCTTCAGAGATACCGAGAAATCTGCA
CTTGATTGCTCGCGCTGCCAGCTTCTTGTCCTTTCGGACAGCTGCAGGCACGTAGGCAAAGCACACGCAACCCCATACCTGGAGTGTCTTTTTTTTGTCC
GGGTGTGCCCCTTTTACTAATCCATACGGTGTCCTGTTCTTTAGGCGACTCATGGTGGTGCAGTTTTGCCTCTGGCCACCATTTGGCTGCCATGTTTGCA
TCCCGGAGGGCACAGCGTACTTTTCCCATCTTAGATTGATGGTCTCTCTCTGCCGCTCCATTTTCTTCTGGACTATATGGATTAGAGGTCTGAAACGTTA
TTCCTTTTCCTGTGCAGAATGTTTTTAGCGCTGAATTTACAAATTCCGTGCCGCCATCTGATCTGATGCGCCTTATTGTAAACTTTCCCTCTCTTTCTAG
TTGTGTCAGTAGCTCTTTGACTTTTATCTGTACCTCCGTTTCTTTCGAAGTACATATGTCCAACGCCATGATGTCTGATCATCAATGATACTGAGAAAGT
ATCTGATAGAGTGTACTGCACCGTATACTCTCAGTGTCGTCATAGGTCCATTAACATCCATATGAATGGTACTAATGGGCTGATTGTCTCTAGACCAACC
ATATTCCTGTAGCTCATCCTGCGCATTTTCATTTCTGTGCATGTGTGGCAGAAGAATGGTATCTTCGTGAGTGCCACCCTACTAAAGCTAGGTAGACCTG
GTATCA