Description :
From Genome Similarity Track
Location :
Scaffold_961:4594- 6580
Sequence
1986 bases(100 bases per row)
GCCGCGAATCCCGACCAAGTCGACTACGATGATGCCGAGGTATCCTTCTATCATGAGGGCACCGACGCTAGTCAGTTGGAAGAGCTGAGGTCCAAACTCG
CGATGCTCCCCGAGCTTCGTGACCTCGACCTCAAAGTCGACCTTCGGGATGCCGATGTCGGAGAGCCCGATgaGTCCACTGGGGgAgAGGTGGCCCAAGT
TCGAGAAATCCTCGCCAAGCATCAGGTCGCTTTCTTGGGATCCAAGAACGCGCTGCCTCCACCGGCCCGGGGCGTAGTGTGTGACATTGAGCTCGAGTTG
GGAACCGAGCCTGTCgCCCAGAAGCCGCGACGGATCCAAGCCAAGTTGTTCCCCCAGGTGTACGAGCTCCTGGAGAAACTTCTCGAAGCCAAGTTGATTG
AGTTCTCGAACTCTCCTTGGGCGAGTCCGATCGTCATTGTCcTAAAGAAAAaTAGGAAAGACATCAGACTCTGCATCGATTACCGTCTCGTGAATCGGCT
CATCAAGCTGATGACTTACCCGCTTCCGCTCATTGACGAGCTTCTCGAGACCTTTCGGAAAACCATGTGGTTCTTGAGTCTCGACATGGCAAGTGGGTTg
TGGgCCATCACGATGACACCgAGGGCACAaGAAATCAGTGCCTTCATCTGTCCTTTGGGACACTtCCAgTGGGTACGCATGCCGTTCGGGTtGAAGAACG
CACCGTtGCTATACCAGAAGGTTCTCGACAACTGCCTCTGGGGATTCGTGCGCCTGCCTCCCGAGATCGAAAAGGAGGTGGAGCCAGAAGTCCTCGAAGG
TCTGGGCCAGAGTCCCGACGAAGACATCCCGAGACTCGACCGAGGTCTCGAAAGTGAGGGTGCTGTCTTCGATATCGGGATCCCCACGCCCTCATGCATG
AGTCCCGTGTTGGGACGGAGCTCGTATATCGACGACATCGCGTATGGGGCGAAGACATGGGCCGAGATGTGTGAAGTACtcGACAAGTTGCTGTATAGGC
TACGATATTGGCAGATATCGATCAGCCTCCCGAAGAGTGCATTCGGGAaGAAAGCCATCCAGTACTTCTCACACGAAGTATCTCGGTCGGGACTTCGGGC
cACCCCCAAGATCGTCAAGGGAATCGAGAAGCTCGAATTCCCGACTTCACTCAAGGGAATCCAGTCATTCCTCGGGAGTCTGAACAATCATGCGAAGTTC
ATTGAAGATTATGCCGTCCTCGCTAGTGTTCTCTACGAGCTGACCGACGAGCAAGTGCGAACTGGTCGGGACCTCGACAAAGCACGCCGGGCCTTCGAAA
TCTtGAAATCGAGAGTCCAGTCGACACCCATCCTGAAGCATCCCGAGCGGGGCCGAGGGTTCTCGATAATCCTCCACGCCAACAAGTGGGCCATAGCTGC
AGTCTTGGCACAGGAACACGACGGGACGCTGCATCCCGTCCGCTTCGCGGGACGCACGCTTCAGGATGCCGAGCTCCGGTGCCAGGTCGCCGAGAAAGAA
GTTCTCGCGCTAATGCGCGTTCTGCACACTTGCTACACGCTTGTAGTGGGAGAAAaGCTGACCGTCTACGCTCGACACTCGGTGTTAAAATGGCTGCtCG
AGACTCGAGCAGTCGCGGGAAGAGTGCTCCAGTGGGCCACATACCTGTCGCCTTGGGATATCGAGGTGCCCAAAGTCGCTGGGGATGCGGACGGCCTAGC
TCACCTATTCGCTGCTACAATCACGCCGCACGAGAAGCTTGATGAAGTCGCGGTAGAGCTGGAACCTCGAAAAGCTTCGAGAAGTAAGCGCGTTCCTATC
GAGTCAGAAGCGGTGAGTCTCGAGTACGAAGGTGTTGTAATGACGTTCGATGGATCTGCAAAGCTGAAGACAAAGTCGGGAAGCGGGAGCTATATTCTGT
GGCGATTACCGGCCTGGGACATCCTCGAAGCTGGCGGGgTCAAGCTGGACAACGTGTCCGTGAATGAAGCCGAaTACGCCGGgATG