Description :
From Genome Similarity Track
Location :
Scaffold_1149:4594- 6327
Transcript NameFunction/comments
Pytar_ATCC12531fgenesh_masked-par_contig_1149-abinit-gene-0.4Cleavage induced predicted protein

Sequence
1733 bases(100 bases per row)
CAAGAGGAAGAAGAAGCCCAGGATCGCAGCCCCCCACAAAACGCGGTCTTGGGGCTTGCTGAAGTCGCAGTTGGCTCGCATGGCAAGGAGGAGGGGCTTG
GTGGCTGGTCGTTTGCTTCTTGGCGCTGGCGACATCCTCTGCATCCCCCGCACAGCTTGTCGGTGTCCAGCGTGGAGGCCGACGCGGTACCCGACGGCTG
CTTGATGATGCCACGAGACGTGGCTGATCTTGGACAGCACGGTGGCGGCGCAGTTTCCACTTCGCCAACTGCTGGTCGCGTAGAGCGCGAGGATGAGGGA
GTGACGTTCCTCGTCGCGTGGCAGGATGCTTGGGAGACCTCTGTGGGTCGTCCACTGCCGCCATTCTCGCCATGTAGCATCGTACTTCCGTCGCGACGAC
TCGGCCAGAGCTGCGGACTGCAGCTGTTGGAGAAGGTCGAGTAGATCTTTCGTGTCTCCGTCGGCACTGCCACCTGCGTCCATCCAACTGAAAGGTTAGT
CCAAGTACGGCCAAATGGTTCGGTCCAGGCGCGCGATCCGGCGTCTGCCATGACGTTGCTTTCTCCGGGTAGGTGTCGAGCCGTCATTCTGAATCCGTCC
ACCGCCTCGCGGAGGCCGATGGCGCGATTGATCTCCTGACTGAGCGCGTTGCGGCTGGCCTTTGCATTATTCCATGCGACGGCCGCTGCGTTNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNCTCGCGTACATTGATGCTGAATTCGTCGGTGTGGTCTCGCCCAGGGGCACTGGCGTGTATCCAGGTGAGCTCTTCACGGTCGAACCGGACCTGGA
TGTACTCCTTGTGCGCTGGGTCTAAGACGACCAATCCTTCGTTGCTGGCGTCCGTGTAGACATGGGCAGTCGGCGCTGCCATGTTCGCGAGCAGGGCAGT
CGGCAGGTGTCGGAGCTGCCCGTGGCGTAAGATGTGCTCGAACCACCGCAAATCTTGATTTGCGGCAGCCGATANNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGCTGCCGGCACGCACGTGCTGACGTGTCGCAGGCTCCCTAGGAGCTTCCGCAGAGCGGTT
CTCGTCGTGTACGGCCGAGCTCTCATGTCATCGACACGACCCAAGGCCTTGGCGATCTTGTCTAATGGCATGGGTACCGTGCGTTCCTTAGTGTCGAACT
CGAGACCCAGCACTCGCAGCCGCGTGCTCCATGGAGTGAATTTCTTTTCGCTGACTGCTCGCGGCCCGAGAATGGCCATCATGGCCAGTCGCAATGCCTG
ATTCGCCCAGTGCAGTCGGTCCTTGCGCGACGGCTCGATCATCACGTGGTCGTCGATCCACTCGTATCCGAAGAACGGTTCGTCATCAGAGTTCGAGCCG
CTCATTGACACCGGTGATTCCCGCTGCACCAGCCACGTGATGGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAACCATTCCGTAGTACG
CCGGAGATGCGGTCCAGCCAAAAGGCGCGGACATGTCGACTACCAGCACTCTGTCCCGTGGCAGGCGGCCTCCCATTCGGTAGACGTCCGCGGCCCGCAG
CATCAGGTGACGGTAGGCTCCCTTGACATCCCC