Description :
From Genome Similarity Track
Location :
contig_61:45939- 47354
Transcript NameFunction/comments
g9183.t1mannosyl-oligosaccharide alpha-1,2-mannosidase, putative
g9184.t1hypothetical protein PHYSODRAFT_350701

Sequence
1415 bases(100 bases per row)
GCAGCTCACGCTGTCTCACCAAGCGCGAAACTACTCGCGCGTCGTGGACTGGTGGGCGTTTGCGTGCGTGGTGTACGAAATGGTCAGCGGTTCCCCGCCG
TTCACGACGCGCCGCAACGGCTCGCACTTTGAGCTCTACACTCGCATCCTCTCGGGCAAGATCTATTGGCCGCGGTACATGCAGAGCTCGTTGAAGGACT
TGCTGCGGCAAATGTTGCAGCCCGACCCAGCCAAGCGACTGAGCGACGCAGCGGATATCAAGAAGCACGTGTGGTTTGAAAACGTAGACTGGGACGTCGT
CCCGCTCCGACAAGTGGCTGCGCCGTACGTCCCGAGACTGGCCTGTGCAGGCGACACGACCAACTTCGACGAGTACCCGAGCTCATGCGAGGAGACCCCA
CCGCTCGATAACGACCCCTCTCGACAAGAGTTCCGCAACTTCTGACACGCAGCCCGCTACGACGGACATCCAAATCGCCACAACAATCACGCCAAGGTGG
CAATCATGGCGAGGGAGTCCAACGAGCCAGACGTGCTTCACCGATTACCAGACGCTCAATAATTCGTCCTGGTACGGAGCGGCAGATGGCACCGCAGCGT
CGTGAACGTTTTACGGTGAAAGTGCTGCATACGCGTCACATGGCGACCGTATGAACTCGACGAACAGAAGCAGCTCCTGCCACTTTGCGCCGTCTGCAGA
ACACTTCAACAAGGGCGATACAGCGCGCTCATGGATTTTCAAACGGCTGCAACATACGATCGTTCACTGCAGCTTGGTACGATGAGAGTCGGGGCTGCCA
GCACTTCTATCACCCCCTACTGTTTCCAAGCAAGCGGTATGGATGGCCACCTCGGTATTCAAACACTCGACGCAATCTACCGGAGCAGCGGGATCTGTAG
ACAACCAGCAGTGGAGCAACGACAGATATTATACATACCAGCAGCGAAAACTCAATAAAGTCGACTTCCATGGTGGCCGAAATGGCTGGGGAAAGGCGAG
ACAGGGTTTGTTTCGGCTGTCCTTCTCCGCTGTTTCGGTTTCACTATAGCTGCTCGCATCGTGAGTGCTTTGCCGCCACCTCGGGCCTCTTCACTCGAGA
ATCGAGACTGGAGCGTTCACGTCCACGGTGATTCGTGGCCCGAGCGTCCGAGGAGAAGCCGAGAAGAAGTGCAGGAGCTGCAGCGTGCAGAGACCGGCAG
CGAGCGATACAAAGCCACAAGCGGCTTACTCAGCGCGTCAAACATGGCCAAAGACAACCACAGTCCGTCCCTGGACCCGCTGCACTCTCCAGGAAGCGAC
ACACCGCAGCAGCAACAGTCTCCGGTACGCAGCACCTGGAGCAGAGCACAAGACGCCGCCAAACAGAATCAGGTTAAGCAGGACACAGCGGACCCCATGG
CCAAGACCAAGCGAC