Description :
From Genome Similarity Track
Location :
Scaffold_90:45933- 48168
Transcript NameFunction/comments
Phyra_83517Hypothetical protein
Phyra_83518CD4-specific ankyrin repeat protein D3.1

Sequence
2235 bases(100 bases per row)
GGTGCATCTGGATCGCATGAACCAGATCTCGGCGAATCTGCGCGATATGCGCAAGGAGATGAAGGAGACGACTGAGGCTCCTGCCAGTACGCAGTCGGCG
ATGGCGGCACTCACCACGTTCGAGACCAAGGCCAATGCCGAGCGTGCCGCCAAGATTGCGGCCAACTTCATCAGTTTGCTGGACCGAAATGCGGCCCCTG
CAGCTCGTCGCGCGCAGCAGCAGCTCAAGCAGCTTGGTGGGCCTCGCACGAGTTTGTTCAATTTGACACTGGCCATGGGCGATGGAAGCTTCGTGGATTA
CCTCATGGACTCGACGTTTGAGGATGTTGGAGAGAGCCCCGATGGCACCGGCTTGGGGTGGCAGTCGGTGCAGTCACAGACGACAGGCAAGCAGTATTTC
TTCAACCAGAACTGCGCGCTCGCGTCCTGGACTCTTCCGGGGCCCGACGTCTTCCGGGGAACGCTTTACATTGTGCTCTAAACTCTCTGGAGGTGTGCAC
TCGCCAACGTATTATTTAGCTAGCAAAGGAGAGAACCTGAATCCATCCGTGTACAGTTCTGCGTCTATGGAAACCAGAGCTCAAACAAATAAAGAAAGTG
ACGTCCATCCATTGGTGTACCTGTGCGGAGCTACAATGAACCAAGTTAAACAGGTCACCTTCACCGGTACGGGCAGTCTTCCGAGCTGTGCGCGGTGGCG
GGCATACTGCAGTGGATACATTCGGCGCCCTTGGGCGTGCCTACGTCCACAGACGAGGTGATGCTGGAGCGTGGTGTAGGGGGCTTCTTGTCCAGGACGG
AAGCCGCCAAATTTGCAAAGCGTGAGGAAAAACTGGCGAGGCCGGAGCTGGGCGTCGAAGGTCTAGCGGAAACTGGCACGGGCGGCGGCAGTGAGCCACT
GGACGTGATAGATGTGCGCTGGTTCGAGGCCTCAGAGGCGGTGTCCGTCATGCTGCGGTTGCGTGGCGAGCCTGGGCGGAAGACAGCGAACCGGATGAGC
TTCTCCTTCCGTGCCAGCTTGCCCAGAAGCTGAGTGACCTGCTGCAAGGACATCAGCGACGCGTTGGTCTCGTTGATGCTCATGATGTACATGCCCGGGT
ACACGTCACCGTGAGCTTCAATTGGCCCTTTCTCACCAGTCGGCAAGTTGGTGAAGCCGTGCACGACCGCGCACTCCTGGATGCCGCTATCGAGCAGTAC
ACCCAGCGGGCCAGGCGGCACACGCACTTCCACGATCTCTTCGATCTCATTGTCACTCTCACTATCACTGTCGTTGTCGAAGAAAGCTGCTCCTTGGAGC
GCGCCCTGCAACATGGCGTCGTAGTCCTCCGGCAGCGTCACAGGGATCTCTGCGTACTGGTAGTCGAACTTGCGGAGCTCCTCGTAATACGGGTTGGACC
CAATGATCTTGTAGTCTGTGCCGGCCCAGAGGTTCACCAGCTTGGCCTCTCCTTTGTCTTCATAATAAAGGCCGCGTAAACTGCTCGTGCGGATGCTCGT
GCTGGGCTCGAAGAAGACGACGGTGGCCTTGCGACCCAGATGGGAGATCACCTTGCCATTGAGACTTTCAGGCTCTATAGCAACAGCAAGTATTAGTACC
CACAATAGTATTACTACTCTCTACACGTTCACGTCCCACCTTTCATCGGCGCCACGCAGCCTTGGGACCGCAGCAACTCGATGATCTGCAAGTGTCCTCT
CCAGATGGCGAGGTCCAGCGCCGAGTATCCGTCCTGAGAGTCAGCAAGAGTCAAGGTTACTACTCTGATCAAGTGTAATACTACCATGATAGCACTACTA
ACATCCGTGAGGGCGAGCACGTCGGCCCCGTACTGCAGCAGCATCATGGCGATCTGCGTGTTGCCCACGAGGCAGGCGCAGTGCAGCATGGAGAAGCCGC
CGCTCTCCGTGAGCGCCGCCACGTCCGCCTTGCCGATCTTGAGCGTCAGGTAGCGCCGCGCCTTCTCCACGCTGCCCTCCAGGATGGCCTCGCGCAGATA
CTGGTTGCTCTTGCCCTGCAGCAGATTCATCTTCGTTTTGATAGTGATCGTCGCGAACCCAGAATGAATTACCCACCAAAATCAGAAAAGCGTAACCAGG
GTACGTGTATCCTAATTGCCGATTTGCGAGATCAACAAAAGATGACCTCAACCCAGAGCAAAGCTAGCATAACGACTGATCTCCTTACTAGTGCACTACG
CATAGTGCCGAAAGCTGGACACGGTAGAATGCGTT