Description :
From Genome Similarity Track
Location :
scaffold_1030:4593- 5904
Sequence
1311 bases(100 bases per row)
TCGAACTCGTACAACAACGCTCCGTAGCTTAGCCGTGACACGGAAACCCATTCAGGATCGGCATAACGATTCCACTTGACGAGATATTCTCTGGATCGCT
TGGATTTGCGGTTCGTTTCACCCATCGTATATCCTGAATGCTCTCCGCTTCGTATTCGTTATTCGCGTTATCAGGTTCCCAACTGTCCTCAGGTAATAGC
GCTGCGTCCATCATCATCTTCGACTTCAATCTCGAATATGGGCCTTTTTGGAAAATAGCCCTCGGTTTGAGTCGACTGATGTGCACCCAAGGGTTTACTC
GGTATCCCGAGTCCTCGACCTTGAGATTCACTCGAAAATCATCTCGGACTTCCTCAATTCGGAATGGTCCACGCCACATGTGTGCCAGTTTCCGGCTCAA
TCCAGGTTGGATCTTCGAGATGTAAAGCCAAACGGCATCTCCCTTCTCCAAAACTGCCTTCAGGCGATCAGATAACTTACGCCTCTTTCGGGTTTGATCT
TCAGAACACGCGCTTCGCTTTTCGCTGAAGCTCTTCTGCACAAGCTAAGGCATAGCTGTAATATCTCTGAAGCTTTCGTCGCCATTCATGAGCAGTTCGC
TCAGGCATAGTTGAAGGCTTGGATCCCAACATTGCAGACATAGTTCCTTGGGCGTCCCATCCGTGGGCGAGATAGAACGGGGTGTCCAGGCGAGTCGCGT
CGAAGGACGTATTCAGGGGAAACATCAGCCTTTCGGTGTATTAGTCCCAGTCAGATCGATCAACCTCCGCAACATACACCTCGACACTCCGTATGACAGT
CTGTACAGAACGTTCTTGTTGACCGCTCGCTTGGGGTCGACACGCGAGAGTCGCTCTCTGCTTACTCCTTATGAGATCTCGGAACCTCGTGAAGACCTCG
CTCATGAAGCGAGCATCCTGGTCATGCTGAATTACCGAGGATGACCCGAATCTCCGAAAAACGGACTCTTCGTACGCTTCAGCGACATCTTGGACAGTTG
TTGACGACATTGGCTTACACATCCCATAACCCGAGAACATATCTTGGAACAGTAGTAGGAACGTGTTCCCTCGGACTGACTCCGGCAGATGGGTCACGAA
ATCCATCGAGACAGCCTCAAATGATCGTGTTGGCTCGATATGTTCCAGCGTTCGGGGGTGCCCCTTCACGCTAGCACAACCGATACCTTCTTTCACGAAC
CGTTCCACGTCAGCATACATGCCTGGCCAGTAGAACCCTAAGCGCAATTCCTCGTGGGTATACCTTGGTACCCACCCTGAAAATCTTCATGCGCGTAGTG
CAGCATGTCTT