Description :
From Genome Similarity Track
Location :
Scaffold_199:45910- 47667
Sequence
1757 bases(100 bases per row)
GGGTTGTGTATGGAAACATGTACTTACTGGGAAGGGTGATACATACAAATGTCTAGCTAAGAGGATTTGAGGATAATAGATTTGATGACATTAAGTATGC
AGTTATGTGATATATATCCGTACTTATTACATGCCATACTAAAAAAATGTTAACGTCCCAGGGGCCCAGCCGTCGAACGTGATGCCAGATTGGGAGCCTA
TGTCGGCCGCAATTCGGTCACCCACCTTGGCGCACATGACGCATGTAGAGCACCAGCGTCTTCGGCGAGACGGGCTTCAGCGTGGCTCATGAGCGTGTCA
TCGGATCGTCCGCCTCACTCAGCGTTTGGTTCCTGGCAATGATCCACTCTATCCACTTGTAGATCTCCATCGTGCGCTGGTCGACGAACCCATGCGCTTC
GAGCGTTTGTCCAGGCGCGTGCTGGCTCGCTTCAAGCGGACTCGGTGTAACCGGGGTGCTTGTCACGAGGTGGCTGATCAGGTTCGTGTAGCCTGTACTA
GACGCCTGCTTGCGCATCGTTTAGCACGGCTTCCACTATCGTCAGCTTGATAGGCGAGGCGGTATTTGAAATGTGGTTCATATGCTCGCGACACCACATG
GTGGTGGGGCTGATGACAACTCGGTCCGGGTCGCGCATGTATGCCTTCTGGGCGCGTTCCACCCAGTCAGAAAGTCCAACCCTGCAATAAAGGCATCGAA
AAAAGGCATTGAGACCTTTCACATCACAAGGACAATACCTAGGAACATTTAGCTGCATTTGTATAGTATCCACCTCCTCTATACTTGATCGAAATCAAGC
CAAAATGTCGTCATTTTGATTCTATATCAAACAATCCAAAACGGGCCGAGATCCAAGCGACTATTCGAGCTATCATAATGCTAATCCGTGTGGAAGAAGC
GAGCACTGAAGTGGCTGTGGGTCTACGTAAAATGAGCTGCGCGTGGTTGTTGCTGGCAGGCCGATTTATTATGGCAAGCTCTGGGACACTATTGCGTACT
TCTATGTATGGTACTTATTTTTATTTTCCTTTCTTATCTAGGTCGGGCTTACGAAAGAGTGACATTGAACGTATTAAAATGTTAATTTAACGAGCACCTC
GTAACCCCGATATTATCATTTCCGCTTCTTTAATCGATGACAACATGTTGGAGACCTCGTTCAATGCTGCTGCGAAATGATGACAGGATGCCTTGCTGGT
GGAACGTGAGGCTGCTGATGGAGAACTATTCTTAAGTCAGTCTCAGGATTGATGCACAGCCGGACATGGGAAAGCTCCGACGTCGTGGGAATGTCAAAGT
ACTTTCATCGTTCGCTTCTAGAAATACAACATTTTTGCGCTGTTGGCTACTGTCCCGTACAGTTTCATTTGGCAAGCACGCTTAAACCCCTAGTTACCAC
TCGAACGTTGAAGCTGGGGCGCCCAAGGTGTCGAATGCCTTCGAAGACGTCGAAGACACGGTGCCAACTGACTCTTCCATGCTTGCGCAGAACGATTCAT
TGCTTAGGGCAATTGGCAAGCGCGAAAATATCGAGTCGGTGCTGCATCTAGATCCGGTGACCTAGATTGAGATAACAACATCTTGTGGACCGTTTTGGGG
TAGCACGAAGCTCATTAAAAGTCGCGTGACTCAAATAAATGTTTCACCTTGCCCCCAGCGCGCTTACCGTCTCGACAAAGTTATGGAGGTTCATTGACTA
CCCCTACTTCTTCTGTTTTTATTTTTTTTGCTCACCTGATGTACCTGTCGACCGGCT