Description :
From Genome Similarity Track
Location :
Scaffold_391:4590- 7564
Sequence
2974 bases(100 bases per row)
CACGGGTTGCTGCTGAGTTACGAGCTGCTAGCTAAACAGACAAGGGGTTAAGTTGTCATCTGTGGTGATTCCAACCTGGTCATCAGGAAGATGTGGGACG
AGATTGATTTCAAGGCACCAGGGAATAATTGTTGCGTTACAAGGCCTTAGATAAACTCAAGTCGTGGCCTACACATGAGTTCTTACACTTTAAGCGCGAT
TGGAATCAAAGTGCAGATCGTTTGGCTAACACCGCTATACAGGTTAGCAAGGCATGATTACGCTAACTGAGCAGGATCTCCTGGATCTGTGCACCATCAA
TCAATTACCCGACATACTGACACCAGTATGTAGTGATAAGGTGAAGAAGATGGCGTCGATCACACGATCGACTATGCGAAGACGTGAGGCGTAAACCATT
ATGCAGAGAGAAGTGGTACAGCAGATGCTACTCAACAGTATAAAGCAGGCGCAAGACGAGGAGATATGGATAGCTAACCTCAAGCCTTACTTATTCAGAG
GTGTAACCATGTTGTGAGCCGTGGAAGCAAAAGCAAGTGCCGTGATTGCCCTAGACTACGTAGTAGATGAAGGCGGATTGTTGTATTTTTTCCTGTGATT
GGCAACAAATCTCGATAATCGTGCTGAACTTGTTCGTCTGGTGATCTCAGAATTGCTCCAGGACTATATTCTACATCATTACCATGCAAGTCTGGAAAGG
GATATCAAGGAGTGAGCCGCACGTATCATCGCGTACGATCGCACTTTCATCGGAGAGGTTTGTTCCGAAGCGTGCAACGGTATGTGGGGAAGTGTGTCGA
CTGTGAAACCGGGAAGGGATGTCCGGTGCTACGCGGAGAATACCCGGAAAAACGTGCGAGCTACGTATTCATTTCAGATGATTGCAATGGACCATATCCC
TCCCTGCCATGGTCATTCAAAGGTAACGCAAAATTGTTTATGTGGGTTGGTCTGTTTTCTGGCTACGTGATTACTAAGGTTAGCTCATCGAGGCCTTCCA
AAACAATTGCGGAAGGGTGTGAAGAATGCGTCTTGCGGTGATTTGGGGCGAGTAATCTATTCGTCATGATCGCGAGCCTAGGTTCATGTCAGGTTTCTTT
CGAGCATTCAACCGTATTGCCGGTCAGAAACAACGCGCTGTAATGGCATATCGCCCTCAAGCCAATGGCTTCGCCGTGCGGATGGTACAAACATTGACCA
GGGCGCTCAAGATGGTTATCACCGATTTGAACCAACAAGGGTGGGACGAGTATGCCGAGCGACTGCCCTTCGCCAGCAATACAGCGCATCACCGATTCCG
TAGTGATAAACCGTTCTATCTCCTTCACGGATATGACCCGCAATCAACTTTGGAAGCAAACCTTCTGTTGAGGCGCACTAAAACACGTGGTCGAACCGGA
GGAGATGGCGTTATCATATACAGCGACGTACAACCGTGCACGGGCCACCTTGAGTTATCAACTGAAAGAAGCCATCCAGTACCGGGCCGATCAACACAAA
AATGATCAAGAATCACATGGAATAAGCTGTGGTATCAAGTGTGGATGTATTTGGACCTAATGATAGAGGTATATGCTAGAAGAGTGGTCCACGTGTGGCT
GGTCCATTTTGGGTGATTTGGAAGTGCGGGGAACGTGCAGTACGACTCGAAGTGCAAGGGACCCCATACCGACTATTCCCGCTCGTGTATATATCAAAGC
TGAAGCTGGTCCGAAGAATACCTGACCTACCTATTGCACGGCTACAGGTGTGAGAGCTCAAACGAGTGGATTTTGATGAAGCCCTGCTTCCGGAGGCCAG
CTGGGTAGGTAAATTGGCGGAAGGGGAATACGAGGTGGACAGTATCAGAGATGTGCTATCCGGACGGAAAACGCGGTGTAGAAGAACGCACCGACAGTTT
CTAGTCCGGTGGAAAGGTCATCAAGATAAAACATGGGTGGATGAAGCAAACCTCAATTGTGGCGCATTGTTACAGAAATTTGAACTCGATCGAGCTAAAC
GGAATCAGTTCGAAGTGATGCAAATACAAGAAGATGAGCTCAGATGTTAGGGTGACCAGAAGTGCTTACCTCGACCGCGAATTGTGGTGATCATCTGGTT
CGTGAGCGAAAAGGGCTAGGACCATGTGAGTTGGCAATGAGGAGAGGTTACACGGTCGATGAACGGAGCGATCATAGAATGTGAAAACGATTGAAGTACA
ATGAAGGCAGGATAAATAGATATGACCGGATATCACAACTGCTATCATGAACATTATTGTCCTTCTGGAAGAGCCAACAAGCTAATTCTCCACGAACTTA
TCCTTGAGGCGGCAAATGGATGACCTAGGGTGATCGGTGATCGACGTACGATATTGATTTCGCCAGCGATCAGCAGAGTCCGTCAAGTGCAGGGCGGAAG
CCAAATTGGAAACATTTGGTCTGCTGGCAGACGAAACCCGGATACCACATGCACTTCTCCAGTCGTCCGGGAAATTGCAAAAAAAGGGATCTAGCAGGAT
GTCGAGGTCACATCAACCCTCGATCAACCCCTGCAACACGATCCGGAGTACTTATTTTCAACGGGGCCGGAACTTGAACGTCTACGTCGCCTTTCCTCAT
AGTAGATACTCAACCCAGAATCCTTCGAGCGGCTACGACCGACGATGATCGGCAACACATTCAACTCCCATAGCGACTGGCGGTGATGATCTTCGAGGTT
GCGGTAGGCGTTCACCAACGCTTGAAACCAGCCAGTCGGACGGAAGGATACGGGTGCGAGCTTACCATCCAGGACATCCAACAGACTCTAATTATATAAG
GTATATTCCTGCGCCGAGGCCACAAGTCGCGGAGACCATTATGACTCGGCAGTCGGGCGAGCAAGGTTCAGGTACTGAAAACAAGTAACGCTTGGGTTGA
GAGAAGTGACGAAACAAATTGTCCACGTTCAGTTCGCTCACCTTGATCAAACTCAAGCGGCGAGTCGACCGCGG