Description :
From Genome Similarity Track
Location :
scaffold_39:4590- 6034
Transcript NameFunction/comments
Plaha_PHALS_15005hypothetical protein

Sequence
1444 bases(100 bases per row)
AGCGTCTCAATCTGAAGAAGATCGCGTCGCTTTTGCGCAGAAAACGCCAGGTGGAAAACCAAATGCTTTCGAAAAGGGAGCTACGATACATTGTGATACA
TACGTACTAGACAGTATGTACACCTTTTGAACAACGCTCTTACATGTCCAGGCGTTGTAAATTAATAGCCTACCCCATCCGTATACACTTCCAGTTCTGG
CGAAATAAAAGCTTTCACTCGCATTTTCATTTTTACCTTGACATTCACATCCGTCGGAAAGCCCAATGGCTCTGCAGCAAATCGTCCTGTTTCTCGTTTT
TTCGTGCATTGTATCGGCATCAGCCATTTATCAAGGCTTCGGTACAGTTTACACGCTTACCTCGCCTTTTAACGGAAATTGCAATTTCATGCATACGCCT
GACAGAGCAGCAACTAAGTACGCTGCACTTAATACCGAACAATGGGAAGAAACCATGAATTGTGGACGGTGCATTGAAGTTTCGTGCACTGACCCAACAT
GTGCAGGCCGACCGTCGGAGGTCGTGCACATTTTGGACCAATGTCCTGGGTGTGGATATGGTGGCTTGGATCTGTCGCCAGNNNNNNNNNNGAGGCATGA
GCGCAAAAGAAGCTCGAGAGACCCTTTCCAAACAGCCTGATTTCGAAAGCCAAAAGAAATGGCTAGAGGAAACTGTAGTGGAAAATCAACCGGGTTTGGC
AAACATATTCTATCCCAAGTTCCACTGTGAGTTCAACTTCATCGAGTTATATTGGGGATACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNTACTTGCGCGGTCTCCTAAACCTGCAAAAAC