Description :
From Genome Similarity Track
Location :
Scaffold_1118:4590- 5777
Transcript NameFunction/comments
Physo_145375hypothetical protein

Sequence
1187 bases(100 bases per row)
TGCGCGACATTCACTTCATAGTCATCCAGATAACGAGGGCGACGCCGCTCGTGATACTCACGAAGACCAGTCCGGGTTCGCTTCGGCAGCTGCTTGTCAG
CATCCTGATCCACGCGCAGCTCCTCGGACTTCGTCTCGTCGCGGTGCGTCCGCTTTCCCGTCTGCTTGGCGAACTCCATGGCAGCCGAGTCGCCGCCTCC
ATGCTCAGACTGAATGTCTTGCAGGCACTCATCATGATCGTCAATAGTCATTGATCTACACACACTAGCCACCGTAACTTGATCGTCATTAATTACGGAC
TCCTCTTCTCAATAGTCTCATCAATATCATCGACTTCATCCTGAGTTTCCTCCTCATCAATCTCGTCCGGTTGCTCTAACGCAGCGGCGGATCCACAGAC
ACCAGTAGTCGACTCGTTCCCATCGCTCACTTCATCTTCCTGCGGTTTCTCGCTGCTCGCAGTTGCAGCTCGTTGCGTTGCCGCTTGAGATGGCGATGTA
TTGGTCAGCCGTGCATGTGTAGGTCCAACCTTAGTAGGGATCGCTGCCGTCACACCTTCAATGTATGTGATGTGAGCAGCACTTGCCATAAACAGAGTCG
CCTCCCTGCTTTCAGCTCCTTCTGCAACTACAGAACCAGCTGCACCAGACACTGCAGATCGTGCCTCATGCGTCCTATATGGGCAAGCAGCTCTGAGATG
TGCAGTACTCCCACAGATGAAGCACTTCTTCAATTTCTTCTTCTTGGAGTCGCTGCTTTTCTCCTCATGCTGATTATCAGCTCTGCTCTTCCTCCCAATC
ACTCCACTAGCCCCACCATTACTCCCTACACGAGGTCCTCCACGCTGGCCCTTGCCACGGAACTCGACTTGGCGGGCAGCGGCAGCACGAATCAACTCGC
GGACCTTGGTAGGTGTGAACATAGTAGTGTCTGCACTGTAGCGAATTGACGACTTCAGGCTCTCGAACTCTGCTTGGACCGGCAAGCTCTCCAGCATCAT
CTCAACCATGTCAATATCATCAACTGCATACTGCAATGTCTGCAACTAGGTCCGGATATTGAACATCTTGCTCAAGTGCATGTTCATATTTCCACCCGGC
GAAAACTTCACACTCCAGAGTTCATCACGAAGGCGACGAATAGTGTGAGCCTTAACAGTTTTATTCACCTTGTCTCAAACAGGTGAC