Description :
From Genome Similarity Track
Location :
Scaffold_759:459- 3165
Sequence
2706 bases(100 bases per row)
CTTCTCCCTTTCTGAAATATATCTTGCAGTCCTACTAAGATATGGTACCGGACATATTTCAGACCTGATACGGGGTGTCGGAGCCAGGCTCCGATCGGGA
AGTAATATATGGAAAGCGCACTAGCTTACCCAGACCACAGCGATAAAATTGCATTCTGCGCGTCAACTAAATCATCCTGGTGTGCTGTGCGTTGACATCT
CGCTGCTAGAGGGCGGGAGCGGTTTGCTGCCTTCTAGGCAATGCTGCCGTTTGCAGAAGCTGCGCGTTTAGCTAGTCAGTGGCCATTTTGACGTTCCAAT
GGGACGTCATGACGCGTTGGTGCCTGCCCAAGGGCATCTAGGTTGTTGCCGCGGGCGTAAAGCCTACTGCGAGCTCTTGCCGCAGCTTTCTATGTATTCG
ATTTATTGTAACGTGATTGGTCAATTTAGAAAAAACAGTTTAAGGTCGTTTGATACCTGTTTCATACAGTACCAGCTGTGACCATGACCAGCGAATACGT
TCTGAGAAGCGACACACACTGCTGATCATTCCGCGGAAGCGTGAGAACTCCCCCGGACATACGGCTTTCCGATATTCGGGTCAAAGATGAATGAGAACAA
GACCAATGGGACTCATGCCCACCCAATGAGAAAACTGGTGGCGATGAGGCAGACAGTCCGATTGAGCTAGGCCGTGTCTACATCAACAACCGTACAATCG
ATAGTGACTTGCATTTTCTCAAGAGGAACAAGATCCAGCGAGCGTCCAACATACACGGTGAGCGAAGGCCTGTTTGGTATTTACGTGACGGAAAAATGCA
AACACTCGTGACGCACCTGGACCAATGAGGCTCTGAAGCCTAAAGGAAAGTCCAGCGATCGACGCAAACCTAAATGCGTGCATAAGTCTAAATGGCTATG
AGCTTGGTGCCCATCACCGATATCAACGAGTTCTTGCCTGAAAAACTATTTCAAGGCCACCACGACTTCACGGCAACGGTAAGCAGAAATCATTTTCAAG
CGATACGTGGGTCTTCTAATATGCATCCTTCTTTCGACGCTGACGAAGACATTTCCTTTTCGGAAGCTGAACCAGATTTCGATCACCACGATGCCCAACC
GGTCTCGGCCTCAGCCATTAACGTGGGACAAAGGACAATGTGGAACACCGCGTGTTGGAGCTGCCCGACGGCCCGGACGCCCAAAGCACGTGCTTTGGAG
CTACTTCGAAAATGTGACGGATGGGTCGTCGAAGCCGCATGCTGAGTGTAACTACTGCAGAGCTATTGTCCGCAGTGCCCAACCGGGGACGAACATGCAA
CGTCACCTAGAGCTGCACAGATGCCCCTGCCGCTGTTAAACAACGCGTTATTGACTACTTTTCAAGCGTCCAACATTATCCAGTATTTTCAGCAACTGAA
GGGCCTCTTCTTGATTCTGGTGATAATTCACACTCGACTACTGGTGTCAACACTGCACAGTCTGTACCAGTGTCAACACCCGCTCAGCTGCAACTTCAGT
TTGAAGTTGCGTTGGCCGCCATGTTCTACCTGTGTGCACTGCCATTTACGCTGGTGGAATCCGAGGCATTTCGGAGCCCATTTAAGTTGCTGGCCCCGTG
GATCCGATTCCCATCTCGACAAAGACTCAGTGGTGCGTTGCTTCGACAAGCACGTGATCAAATTCGCCAGAAGACTGTTGAAATAATTTGTCTCTATTGT
AACAGATTCCTGGACTAATGTCAACCATTCAACCATTATTAACTTTATGGTCGTGGCTCCGGGAATGCAGTCCATGTTTTGGTCTTCATTAGCACTTGGC
ACGGATTCAGAAACGGGCGAGTATTTGGCAGAACATCTAGGTAGAGTTATTGATGAAGTCGAACGGGAAACAGGGGCCGTAATTGCTGGAATACTGACAG
ACAACGCTAGTAATATGGAGGCTGCAAGAGGAATATTGGAGAGATCTCGATCAATCTTTACAGGAGGTTGCTCTGCTCACGTGTTGAATTTATTGGTTGA
GGACTTGTTCAAGCTGGACTGCTTCAAAGCTGCTCAAATCAAAGCACTTGCTATTACCACGTATGTCCGAGACCATCACGCCGTGCTTAACCAGTTTCAA
ACAACACTGAGCGAGACGCTAAACGGACATCACAGAGCGTTGGTCGTACCCGTCAGCACGCGTTGGTATTCTCTCCACGCATGTCTATCCCGGGTGCTTG
AGAACAAGAACGTGCTAAAAAACCTGTTTTTGGAGCCGCAATTTTCAGATTTAATCCGGAATTCTGCCTCGAGCGCAACAGCTAAAGATAAATGCCGTCA
AGTGAGAAGAAATATCAAAGATCGGGGATTTTGGAATAAGCTTGAACAAGTTGTGGGATTGATTGACCCCGTGATTCAAACCCTTCGTGAGCTCGAGTCA
GACAACTGTCCAATCTCACGCGTTTATTCTCGGTTTCAGGAGCTGCTAAACCACCCTGCTTACGGCACTGAGACTGAACAGTCGGATCTACAAGCGTCAA
TCAAGGCGTGTGTTGAATATCGCTGGGATTTTGTGCACACTGACGCTGCAGGGTTAGCTTTTGTCCTAGACCCCCACACTGACCTGAATCGCTTTGTCGG
CTCCGACGAAGGTGATACTATCGAACAAGGATGTGCGTTTGCAACAAGGACTGGTATACTTACGCGCTTACGAGTGACTAGAAATCAGTTCAATCAAGCT
TTGATT