Description :
From Genome Similarity Track
Location :
Scaffold_3016:459- 1847
Transcript NameFunction/comments
Phypl_g15560hypothetical protein

Sequence
1388 bases(100 bases per row)
CCAggtcgccaccttctctcAACTCAAAGATCCCGCCAACAGGACGCGACGAGCACGGAAAGGTCACCCCAAGGacacctccacgagctgaTCAAGGTAC
ACCAAGACCCTGATCGACTCTACACAACGGCCGAGTAAAGATTTCCACGCGGCTGTCACCAACAATTCCCCAAGTACCGTCCACACAAGCTCAACTCAAG
ATCGCGCCGACATTTTCGCAGTCACCGGAAAAGCGTAACCTGCCCAAccaacgggtacacaagATGAGAAGATTTCAGCCACCACGGACGaacggagtac
cccctccgtaaGTTGGCAGTTTGGGCAACAGTCGGCTAGCTTGGATCGCATCAGCAATTTCGCGTTTCCTCCTCCGCCACAATGGTGCGGGTGCCCGGAT
TTTCTGATGACTCTGGATTGCACCGTGAGTccgccgaagaagatgtcAATATCAAGGTTAAGCCAGGGATTGGTGCGTCGACGGAAGGTGAaccgctgtc
gtcgctgctgaaaaACGAAGGATACACCGATAGTTGGAGCCCTGGGCGGAGTTCCGACAACGTAAAGGAGGAAGGTTCAGCGATGGacctcgaggagaag
cctccatctcctcccCATGTCCCTTCGGGGACCCCCGCGGGTCGCGCGAATGATGGAGATTCATCGGTGAAAACCGAGGGATCTCCATCTACCACCACTC
CTCCGGCCTCGCGCCCGaccttgaagaagaagaccccGCGCATGAAGCTGAGGGCCCCCGAGTCCGACGCGGAAGATCGCAGTGTGCTTGAGAGCTGGAC
CGACGATCAGTTTGAAGCACGCTTCTTCCGAAAGGGactgtacgcgctgctgatcgaGGATCCAGTTTGGAAGATCATGCGGCTGAAGCTGATCGGTGAT
CTTTGAGGACCCGTAACCGCGCCCAGGGAAGTGCTGTACACGCTAGACACGGTGAAATACCTGAAGCGCATTCTGGAGGAAGCTGCGATCGTGCCGAGAG
CGTTCGACGCGAACTTGTGTTTGATCTGGAACTGACCGCGACCACGAAGGCGATGCTCGCTCTCTTCGAGAATGCTGGCTGCTCTGGTTGGAGTGGCCAC
GCTGGTTGCAACGATACTAACACCGCGCAGCGGTTCATCGCAGTACGCGTCAGCTACGTCGGATGCGGGGTCAGACAGTTCAATTGAGGAGAAGAGGATG
ACGCTGGGACCAGCTGGCGCCACCATGCTGGACGTTCGGTAGAAGGAGGCGAAACTGGCCTTGCCACTGGCCGCGCCATTAACCTCCGGGACGTTAGCTA
CGGACCCGGACTCGCCAGATCGCATGCAGACGTTCTTCAACGCTGCGAAATCTCGATTCGTGAAGGAACAGCAAGGGGATCGGATGCc