Description :
From Genome Similarity Track
Location :
Scaffold_5:458974- 461754
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G002486Similar to pol: Pol polyprotein (Fragment) (Mouse mammary tumor virus (strain C3H))

Sequence
2780 bases(100 bases per row)
CGCTTCCTCGTTGCACAAGCGTGTGTGCCGTGTATTGGGAACTGTTGTGAACAGCGTCCCATTACACCTGGTAGCACTTCGAGCGGTCCTTCCAACGACC
CAGTGAAGTGAAAGGTTTGACGACGCGGCTTTAAGCACGTCGCGCATTCCTGTTCAAGACCTACTCTTACCCATGTCCGGGAACATGGAAGGAGTTGATG
TGCCACTCGGTTCAGCAGTACCGCAAACTGTCGAGTTGACGAATGAGTATTTTCCTCATTTGTCTTCTCATGAGTGGTCAGCGCTGGAGCGGATGAGAGA
TGTCATCAGGGAGGCTGCTGTGGTCAGCCTGCTTCGATCGGCATCTCCTGAAGACCAAAAGAGCGCTGCGGTCAGTTTCATGCACCACGAGATTGTTGAA
TCTCGAAAGCAGGTCGCAACCCCTGTTTCGTCCTTCAAGACGATGCCTCTGAAGCTGAACGTGTCTCCGTATCGCGGCGGAGAGAACGAGCCTCTTTCGA
GATGGTTCGTTGAGTTGGATGCAGCAATGTCTGCAAGACAACTCCGTGACCCCTTGCAGCAAGTGTTGTTCGCAATGTCCAACCTTGCGGGTCGTGCGAA
GAGCTGGGCTTATGGGAAGCGTTTGGCCGATCCAAACTGCTTCTATAGCTACGACAATTTCAAGGCAGAACTCAAGATGGCGTTTGAACCACCGCAGAGT
GAGTTCCGTGCACGCGCCGAGTTTCTCAAGCTTCGCCAAGGTCGTTTCGATCTACACTCATATGCTCAGCGAGCTCGTTATCTGGTCTCGAGCATTGTGG
ACGAGCCGATTGACGTCCCAACGCAAGTTGTGACGTTCATGACGGGTCTGAACGACGGTCCAATCCGGAACCAATTGTTCCGTGAGTACCCAAAGACCCT
TGAAGAAGCCATCAGCCGTGCGATGCAAGAAGAGTTTAGCATCAAACAAGCCAAGTTCCAAGGTTTTCCGTCAAGACCACCAAGGCAATCGAACGTCATT
CATGATGGTCCAGAGCCAATGGACATCTCGTACATTTCCACTCCTGGAAATGAACGTCCTCACAACGATGGAAAGTGCTTCCGTTGTGGAAAGTCGGGCC
ACTTCGCTCGAAACTGCAAAGTGTCTTTGCCTGATCGGCAAACGGCACAGGGCTCGCGCTCGAACAACTACGGCCGTAGTAATGGTCGTCGGTTCGATCG
TTCCCAAAGGTCAAAAAACGGGAACGACCAGTAGGGGCGGGGCCTCCTACTGGGCTCGAGAAGAGGACTGTGGATGTTGTGGAAACACAGGACTCTGGCC
CCAATGTGCATGATGCACATGCAGTTTCCACGAGTGAGAGCAGTGTCAGTCAAACGTCAAGTTTGATCGTTCTCAAAGTTCATGTAGACGGTATTGCAAC
ACCTCTACGTGCTTTAGTTGACACTGGTGCGTCGAACAACTTTGTTCGAAATGAAGTGATCACCAGGCACAACGTCTCTGTGCCTGTTGCGAATGAAGAG
AAGATGATGATTGTTCGGTTGGCCAACGGGTCAACTGTGAAGATGCCAAAGCGAGTTGTTCGCTTGGCAATGAAGTATGAAGATTTCCGAGGTGAAGACG
AGTTCATTTTACTCGACCTCGATGACAAGTTTGATATCATCCTGGGCATGCCATGGTTGAAGCGTTACCAACCTAGCATTGACTGGATGAAGATGAAGAT
CTCCGTTGACAAGTCGTGCATCGCCGACTTGAGCTGCATGACAACGGATGAAGTGGTATGGGTTTACACATCTGTGGAAGAAGTCCCAGATGGCCCTTGT
GATATTGCGGCGTGCGATGGCCCCCCATGCTCACAAGCGGCACCCATTTTGAAGAAGACGAACGGAGGTGGAGCAGTCAGGCGCCATAAAAAGACTGTCT
CCTTTGCCATCGACGACAAAGTTGCGTGCGGTGGTAGTGTGAAGAACGACGGGAAAAGAGGCAGAGACCCATCCCAAGACAAGAAGAAGAAGACCAGCAA
GAAGAGTGTTCCGCCAAGAATTTTGAGTGCCCCTGATCAAGGTACAAGTCAAGATGACGAAGGAAGTGTCCAAGCACAAGACATTTCAAGCGAGTTTGTG
AACGTTCTGGTCTCGAACGAAGATGGTGACGTCGATGTAATCCGTCACATGAAGATTGAAAATCCTCCAAGTTCAGTCGAAGAATTGATTTCCTTGCCAT
GGATGAGCAAGAAGACGCTGAAGCGTAGCCTAACGAGAGGCGAAATCTCGCAGATCTGCATGATCGTCGATGTTGACGATGCAGAGGACATCGGCACGGT
ATCAGCAACGGAAGCTGAAGTGCTCGATGAAAAGACACGGAAGGAACGGTTCGAGGAGCAGTCGTGGGATGCTCTCAAGATGAATCCCGTGTATGCACTT
GCCAGGGAATTTGAAGACATTTTCCCAGACAAGGTGCCGGACGAATTGCCATTTGATAGAGGCATTCGTCACGAGATTGACGTACTTCCTGGCACGAAGT
ACTGTATCACACGACAGTGGCCGTTGCCAAAGGAACAAGTCGAGGCAATTGACGAGTTCTTTGCGCAACGCGCGAAGGCTGGGCATGTGCGGGAGAGCAA
GTCTCCGCATTGTAGTCCCACTTTTTGTGTGAAGAAGGCGACTGGCGGATGGCGCATTGTTCACGCTTTCAACAAGCTGAACGACGCGACTATTCCTGCT
CAGACTCCGGTTCCACGCAAGGATATGATCCTTGATGGGATGGTTGGCAGCACCGTCTTTAGTGCTATCGATCTGAAAGA