Description :
From Genome Similarity Track
Location :
contig_15:458851- 459857
Sequence
1006 bases(100 bases per row)
CAACCATGAACTTGTTGTTGTGTATATCCAGCAGCCTAAACCCTTTGGTATCTTCAGAGATACCGAGAAATCTGCACTTGATTGCTCGCGCTGCCAGCTT
CTTGTCCTTTCGGACAGCTGCAGGCACGTAGGCAAAGCACACGCAACCCCATACCTGGAGTGTCTTTTTGTCCGGGTGTGCCCCTTTTACTAATTCATAC
GGTGTCCTGTTCTTTAGGCGACTCATGGTGGTGCAGTTTGCCTCTGGCCACCATTTGGCTGCCATGTTTGCATCCCGGAGGGCACAGCGTACTTTTCCCA
TCTTAGATTGATGGTCTCTCTCTGCCGCTCCATTTTCTTCTGGACTATATGGATTAGAGGTCTGAAACGTTATTCCTTTTCCTGTGCAGAATGTTTTAGC
GCTGAATTTACAAATTCCGTGCCGCCATCTGATCTGATGCGCCTTATTGTAAACTTTCCCTCTCTTTCTAGTTGTCAGTAGCTCTTTGACTTTTATCTGT
ACCTCCGTTTCTTTCGAAGTACATATGTCCAACGCCATGATGTCTGATCATCAATGATACTGAGAAAGTATCTGATAGAGCCTACTGCACCGTACACTCC
CAGTGTCTTCATGGGTCCATTAGTATCCATATGAATAGTACTAATGGGCTGGTTGTCTCTAGTGCCAACCATATTCCTGTAGCTCATCCTGCGCATTTTC
ATTTCTGTGCATGTGTGGCAGAAGAATGGTATCTTCGTGAGTGCCACCCTACTAAAGCTAGGTAGACCTGGTATCAGGTTACCACTCATCACCTCAATTA
ACTTATCTCTGTTGAGGTGTCCTAATTTACATGCCACTCCATGAAGGCTGCTTTGACCTGAGTGTGCCCTGCCATCCTAAGGGCATGATAGGCCTTGCTT
TTACAGCAGAGCAGTAAATCTGCCTGTCTCTCAGTGTACGAGCCTGTATATAGTAGGCTCCATTGACTGCAATAGCCACAAAAGCCAGCTCGTGTTTCCA
GAGGAC