Description :
From Genome Similarity Track
Location :
Scaffold_3:458828- 463371
Transcript NameFunction/comments
Physo_127909predicted protein

Sequence
4543 bases(100 bases per row)
TGATCCAGGAGAAGGAGACGCGCTCGCGTGAGTACCTCAAGATCCTGGGCATGTCGGAGAGCGCCATCATCCTGTCGTGGTACATCACGTACTTTGTCAT
CTTCCTCATCAGCGCCATCCTCCAGGCCATCGCAAGCACCGCCGGTCTGTTCCCGAACAGCGACCCCGGTCTCATCTTCCTCTTCTTCCTGCTCTTTTCG
CTCAGCGTGCTCGCGTTCGGCTTCTTCATGAGCACGCTCTTCTCCCGCTCGCGCACTGGGTCGTTCGCTGGCATGGTGCTCTTCTTCTTCATGTACTTCG
TGTCCAGCGGCTTCTCGTCCACATCCTCGATTGGTTCCAAGACGGGCGCGTGCATCTTGCCACCCGTGGCGCTTTCGTTCGGAGTTCAGTCGCTGGCCAC
GGCCGAGTCAACCGGTGTGGGCATGAGCTTCGAGTCGTCAAGCACTGTGGTCGACAACTTTAAGTTCGGGTCTTCCATCGGCATGCTCTTCTTCGACATC
ATCCTGTACACGCTGCTAGGACTCTATCTCGAGCGAGTCATCCCCCGCGAGTACGGCACCGTCGAGAAATGGTACTTCCCCCTGCAGCCGAGCTACTGGG
TCAGAAGCTTCCGCGCCAAAAGATGCTTGAGTAAGGTTAACGATGTGGCCAACAACGTCGTCAACGGGAGTCACGCGGTGCTCGACATTGAGAACCCGAA
CATGGAGGTCGCCAGTGAGGAGCTGCGCCACCAGGAACGAACGGGCGAGGCGCTGGTGATCAGCGATATCAAGAAGGAGTTCGTCGTGCCCGGAGGAATC
AAGCGCGCCGTTCGTGGCGTGAGTCTCGCCATGTACAAGGACCAGATCACGTGCTTGTTGGGCCACAACGGCGCAGGCAAAACCACGCTCATCTCGATGC
TCACGGGTATGATCGCGCCTTCCGCTGGTGATGCCTCGTTCCGCGGGCTGTCACTGGTGCACGACATGGCCGAAATCCGACAGTCTTTGGGACTCTGCTT
CCAGCACGATGTGCTTTACAGCGAACTCACAGTCGAGGAGCACTTGCTGTTCTATGGACGCGTGAAGGGCTATCGCGGTGCAGCGCTCAAAGAGGAGGTG
ATCACGAAGATCACTGAAGTGGGTCTCACCGAGAAGCGACACGTCTTCGCGGGCTCGCTCTCCGGCGGCATGAAGCGTAAGCTGTCGGTGGCTATCTGCC
TGCTCGGCGACAGCTCGCTCGTGTTCTTGGACGAGCCCACGAGCGGAATGGACCCGTACAGTCGACGCAGCACGTGGGAGATCCTGCTCAACAACCGCGC
CAACCGAGTCATGGTCCTCACGACCCACTTCATGGACGAAGCCGACATTCTGGGGGACCGCATCGCTATCATGGCCGAAGGACAACTGCGCTGCTGCGGG
TCGTCCCTCTTCCTGAAGAACCGGTACGGTGCTGGATACAACTTCACGCTGGTCAAGAGCAGTGACCCCGCTAAGCCCTGCAAGGAGACCCAGCTCCATT
CCCTTGTCACGGAACGTGTTCCTTCCGCCAAGGTGTTGAGCAACGTCGGCGCGGAGATCGCCTTCCAGCTGCCGCTAGACTCCACCGCGTCCTTCCCCGC
GCTGTTTGAGGAGCTGGACAGCAAGATGGGCGACTTGGGCGTGCTCTCGTATGGCATTTCAGTCACGACGCTCGAGGAAGTCTTCATCAAAGTGGCCGAG
GCCAACGACGAGGACAACCAGCACACCCTGAACAAGAACGCCGCAAGTCCTGGTGCTGCCGACGCTGGTCTTCCACCCGGTGGCCCAACCATCGCGAGCC
TTACGGGTATGACCATGTTCTTCGTGCACCTTTCAGCGCTCCTGCTCAAGCGCTTCCGCATCGCCAAGCGCGATCGCCGAGTCATCATCTTCAGTGCGCT
CCTCCCTGTGACGCTGCTGGCTGCCGGGTTTATTATTCTCAAGACCAGCTCACTCACGCGGTCGGACGAGAAACTCGCACTCGCCACCGACGACTTCGAA
GCTTCAGTGCCCAATGTCCCGTACTTCTGCGAGGCGGATGACTCCAAGTGGTGCTCCAGTACGCTGGACCTCTTCACAGGCGGCAAACCCTCCCCCTTCA
CGTCCGCGGATATTCCTTCACCGCCGTACACGACATGGCCGACCACCGTCTTCGGCGTTAACTACACTGAGGCAGACCTTGCGAGCTACAGCAACCCACA
CAGCAACGAGTACTGCCTGCGCATGGGAGATCAGATCTACCAGCGTGGCTTCGGCAAGGACGACGACGGCAAGGTCATTCAACCCCCCGTCAAGGGCCAG
TACGGTGGCTACCTCGTGCACGGGTCCGAGAGTGAGCAAATGTTCGGCTACCACCTCTTCGTGAACACTACCGCAGCGCACGGCGCAGTCATCTTCAAGG
CGTTGATGGACCAAGCTCTGTATCGCTTCATGGCCGGCAGCGGATCTGGAGCGACCGACGTGACTTTGAAGGCGAACACGTACCCGCTCCCCATGACCGC
AGCCACTCAAGCCCTCTTTGGGTCGTTCCTGGCCTTCACGGCGTGCATCTTCATCGTTATCGCCTTCGCGTTCTTCCCGGCCTCCATCGTCGGCTTCCTC
GTGAAAGAGAAGCAAGCCGAGCACAACTCCAAGCACCAGCAGCTCGTGTCGGGCGTGAGTTTACCGGCCTTCTGGCTGGCCAACTACCTCTGGGATCTGC
TCACGTACGTCATCCCGTTCATCGCGGCCATCGTGCTCATCCAGATCTTCGACATCGCGGCCTTCACCGGCAACGACTGCGTGAGCTGCACCAGCCAGAC
GTTCCCAGCGATCGTGCTGCTCTTCATCCTCTTCGGGCTGGCCATTTGTCCGTTCACCTACTGCCTCTCGTACTTCTTCAAGGAGCACGCTTCCGCGCAG
ACGTACACGATCATGGCCAACTTCTTGCTAGGCGTTGTGCTCATGGTCGTGTCCTTCATCCTGGACGTCGTAAGTACGAGCAGCGCCGATGCCAACAAAG
TCCTCAAGTTCTTCTGGCGCCTCAGTCCGCTCTTCAACCTGGGCAGTGCGCTGCTCAACCAGTGCCTCAGCGAGATCACGGCAGCCTTCGGTCGCACATC
CGGGACGGTCAGCCCGTTCGACATGGATGTCATGGGCTGGGAGCTGCTCTACCTGGCGCTGGATGCCATCATCTTCTTCACGGTCGCGGTTGGCATCGAC
TTCCTACTGAGCTTCCCGAAGATTAAAGCCGCGATCTTCAAGGACCCGCACCTGGAGGACGCTCCGTATGAAGAGGACGAGGACGTGGCCCGCGAGGCTG
AACGCGTACGCAGTGGCGGAGCTGACGGCGACGCTGTGAAGCTGCTTGGCATTCGCAAGGTGTACAATGGCAACAAGGTGGCCGTGCGCAACTTGTCGTT
CGGTCTGCCCAAGGGCGAATGCTTCGGCTACTTGGGTATCAACGGAGCTGGCAAGACCACGACCATGAAGATGATGACAGGCGACATCCTCCCGACCACG
GGCAGCGGCACACTTGGCGGCTTCGACATCCTCGGAGAGCAACTGGAAGTCCGTCGCTTGATCGGCTACTGCCCGCAGTTTGACGCGCTGTTCGAGCTGA
TGTCGGTGCGCGAGCACCTGGAGCTCTTCGCGCGTATCAAGGGCGTATCGAGCGCGAACTTGAACGACGTCGTCAAGATTCTCATGCACCAGATGAACTT
GGACGACTTCGAGAACAAACTGGCCGGGACGCTCAGTGGCGGCAACAAGCGCAAGCTCTCGGTGGCCATCGCTCTGATCGGGTCGCCGCCGATTGTGTTC
CTGGACGAGCCCTCGACTGGCATGGACCCCGTGTCTCGCCGCTTCATGTGGAATGTCATCGCTGCGATTTCCACGCAGCGCAAGGAATCGACCATCATCC
TCACCACGCACTCGATGGAGGAGTGTGAGGCGCTCTGCACGCGAGTGGGCATCATGGTCGGTGGTCGTCTGCGATGTCTTGGCAGCGTGCAGCACCTGAA
GCACCGCTTCGGAGACGGCTTGATGCTCGAGCTGAAGCTAATGGGTACGCCCACGCATGACATCGACGCGCGCGTGGCTTCCGTCTTCGGTGGCAGCGCC
TCGACGACGACGTTCCCCCGTGCCGAGCTGCGCGCTAAGTGCGAGGCGCTGGGCGACGCGTCTTGGGCCGACAAGATCGTCATGAGTCACGCCACTGGTT
ACGCCTTGGCGACTGCACTCGAACGCGACGGGACCATGCGTCTTGGCATGCTGTGCGCGTGGTGGGCAGCTGAAGAGCGCTTCTTAGGGCTAGACGCGTT
CCTGCGTGAGAGCTTCGCGGTAGATGCCAACACTGGAGTGAAGATGCTGGAGCGGCAGAACGACATGTGTCGATACAAGCTCACGGGCCAGGTGCCGCGA
CTGGCGAGTGTCTTTAGACGCGTGGAGGCCAGCAAGCAGCAGCTCGGCATCCGCGAGTACGCAGTTTCGCAAACTACGCTTGAGCAGATCTTCAACAACT
TCGCAGGTCAGCAGAGCGAGGAGAAGGGCGTCGCGCGCGGCAT