Description :
From Genome Similarity Track
Location :
Scaffold_72:45865- 49537
Sequence
3672 bases(100 bases per row)
ATCAGTCATCCATAGAATAGCGTGGTACACATTAATTCTATCACGAAGTGGTGCTGGATATGCGACTTGTGCAGATTTTGCCGTGTTGCATTTGGTTGGT
GCTGGTTTTGCGATTGACTCTGGATCAACACCGTATCAGATATAACAAGATATCATGTGGAATCAGATCAGCCAGGTTTATCTGTCCATACCTTGAAATC
TCCGACCTCCGACGCGCTCCGACCGGGATAAAGACAGTACTAAATTGTGTAATTGTGTGTTAATTATTATAAGTGGATGGGGGGGCTTAAAATATGATAA
ATTGCGACAAATTGATTGTACTCGATTGACTCAGGTGCCTTGCACGACATGTTCATGTGTTCGTGCTCGAATCTGGTATCTACGTGGTGATCTGCTTCAC
TTCATCGGGAGTAGTGCCAACGTGTTGATCTACTACGACATGCGGACTGTGGACGAGCTATACATGAAAGTGCTTCAATGTATACGTACGTGCACAAGTG
TCCATGTATATCCACACGCACGAAGATTGACTGCGAATGGATCGTTATGTTGTATTCAATGAAAGGTTTGTAAACAGCTACGTGTTGGACAACCTGTCGC
CCAGGTGATGTCCGGACGACCTGTTCACCTGTGCTTAAGTGGTGTACAACACGTTTGCTGCGTACGTGCACATGTGTTCATGTCTATTCACACGCACGAA
GCTTGACTGCAAATTGATCGTTATGTTGTATTCGATGATAGGTACATGGTGGACTACCTGCCGCCCAAATGCTATCCGGACGACCTGTTTTCCCGTGCGT
AAATGGTGTACAGCGCATTTGCTGGGTACGACAACGCGCTGGGCATCAGTGTTGGTAACGAGAACAACCTGCAGATAGAGAATGGTGCCGATGGCACTGC
GACGGCACCATGTGTCAAGTATCTTTACGTGACACACGTAGTTACGCTACGAACTGCTCGGGGTCCATGTGTCAGGTGCCCATCGGTCTCGACATTCCGC
CTCGCGAGCAGTGGATGGTGTAATACGATTTCTTAGTCGATGACGATGAGAATACGCGTGCTTTAGGTATGACGAGTTAATAGTTGATGGAGACTTTTCA
GTGGATGCTGTGACTGAAGTGGATGTAGTGGGTAGATAGGTGGATGGGTGGGAGATTGATCACTATGTGTAACAATCTTTTTGTGGCTGCTTGAACAGGA
TGGGCTTCAACCCGTACGTCAAGTGCGATCAAACGACCGACGTCAAGTACTCGCATCCTTCCAGGCTGAAGAAGCTCATGTCGGTGTACGCGAAAGTCGG
CTATTCTCTTCCGATCATGTGTGGAGAGTTTGTTTGCGACAAGTGCGTGAAAAATATTGACTGCTCGGGAACCAGCGTATGTTCTACAATGTAAGGAGCG
AGAAGAGGGAAAGTGTAAAATGTAGTGAAGATAACAAAGTTGACAAAGATCCTGTTTCGTGTGTGTAGTCCAAGTGAATGAACGATGAGAAGGGGTGACC
TACGAGATCGTGGGTGGCAACGTGTTTAAGTAGACCACCGAAGTCGCCAACCTCGTTGAAACCAAGAGTAAGCTTATAAAGCGGTGAATGTGCATGTGGT
CGGTTGGAAGAACACTAATCATTGATGATTGATGCGTGCTTGTAGCTTTGGCCAACACTGGAGTCGCAAGCAAGAACGTCGTCGGATACTTCCAGCCGGA
ATACAGCGACAATACAAGACCCGGTACAGGTTCAATCCGTACATGAGGTATGAGTACCGGAATAAATTGTAACCGATGAAGGTGGGCTCGACGTCTAGCA
TAAAAGCTGCACGCCGACACGTGATACGATTCTGTCATGTCCCAAGAACATTTTGAGCGAGCTGACCCAGCCGCACAAGGGTGAAATGGATTATTATACT
ATACTGTATATACGCCGCATCATGAGAGTCCGGATGAGCTAACGAGTCTCGCCAATCTTGTTCATATGTGCTTGTTCTAGTCCCCATTCCTTAGTATGCG
ATCCTGCAGCCGGTATACAATGGCGTGAAGACCAACATCTACATGTACTGCGGGGTGGTTATTGATCCAATGATGTTTGTAGTATGCGCAAGTGCTGGAT
CTACAATGCTCCCGGTGGCTTGAAGTTGTCGGTATCGTTGGATGTGTTTGTTAAGATGAACATCTTTGTGCAGCTTGCGCATGGCCTTGAGGACATTTTG
TGCTCCGTGGGATTTGATGTAGTGCTTGCCAAGAAACGAAAGTAACCACATCTAGCGACATCGCCAAACTCCAACACATCGTCTCGATACTGCGGATACT
TCTCGTCAAGCACGAATCCATTAGCGAGAAACAGCTTCATAAATACAGCGACAAGTTTGGAGGTAGATTTCTTGTGCTTGCTGGAGCAATCGAACGAATC
CTAGAGGCGGGGTTCCTGGGTATATCAGGAGAACCATACGTCCTTTAGGTTTGTCGATGAACTCGTTCGGCGACGTTTGGCTGGTGGTTCTTTGCTTTTA
TCCTCACTTCTCTCTTGTCTAGTTTTTGGCTGTGCTTTGTTGTAGACCTCAGCTTCCATCATCGAGACGCGAGAGTCGAACCTTTGGGTGACCTTTATTA
ACTGTTTAATCAATGAAGCTTGATGAAAAAATGTTGGGTGCTTTTGATGTCGATGGTGCTGTCTTGAGCCTTGATGAGATTTGGTTGCATACTTGTCTTT
GTGTAGCAGTTTCGATGCGATGACCAATCTAGAAGATCGCTGACGGAGTGAACTTGCTGGATGAAGCACGCTTCCAAACGTGTGACTACAAGTCAGTATT
TCTTGAGCTGCTTCAATGATGGATAATGAATCAGCAGGTAAATGATAAGCGTTTCAGTAACCCTTTTGTTCACGTTGTACTATGTAGTCGTGAGCCCGTG
AGACGCATTGAAGAGCGCTGTCGCAACAGCTTTGATCTTTGTCTGCGTACCGAAATCGAAGACGTCAAGTGATAGAAAAGATGCGTCGGTATCGAGGTGT
CGCCCACTCAAGACCCGAGCAACCTTGTGGTCTTTGGACGCTGTATTAAAAACGTATGCGAAGGCCTTATTCGTCGCTGTCATATTCCACGCCCCTCGGT
CGAAGATACACTGTACACACAAGCCAGCCCCATTTACATGCTGCTCTTCTCTGCGCCGAAAAGGGTGAGATGTCAAGCGCTCGGATACGCCATCTTTTGC
CGCGACCCGATCAAGAACACGGTTAATGTAGCTGTGCACACCAGCAGCGGTGTCTGGGCTGTTCTTGTTCTTAGCAGTGGTGGACGATGTATCCGGTGAA
GACACCACAACCTCTGGGTGACCGAGCACATCGATGAGCGGAGTTGCTGGAGCTGACGAGGACTGTGAAATACACGTCTGCTCAGGAAGTTGACTCAGCA
CAGATATAGCTGGCGATGAGTGGGTCACGAGGGCGAGCGCTATCGCAAGCAGAGGACATGTGGTGAAGTCTTCGTCCGGATAGAGCGATAGACCTTGCTC
TTCAGAAGTCTTGATGCGGATGAAACGGACGAAGAATATGTCGCCCAATCCGATAGACAGGTTAGCCTTCCGCAGCATTGTGAGGTCTGATGTGCACCTG
AAGAGGAACTAAAGCAGACACAACAGTGCCGCATCTTGGTAGTCAGCACTAGTAACCGCAGTTGAATACAAG