Description :
From Genome Similarity Track
Location :
contig_24:458642- 460117
Transcript NameFunction/comments
g5729.t1hypothetical protein

Sequence
1475 bases(100 bases per row)
CTATCTAGCTAACGTTTATCATGACATGCAAAGTCAGATGGCCACCCTTCGAGGCTCTTGGAACCCATAATTTTAAGGAACCACCACCCGAGCCAGGAAT
GCCAAGCACATTCGATCTCCAACGATCCAGGTACAGCACTTTGTCCTGCAATTTCGAGACAGTGGAGTTCCAGGTTGCCGACCCGTGCGCATTGACGTCT
ACCTCCGCGATGCTTTCACCGCCCGAGTGAATGGTAACTGTCACATCTTTCGAGTCGATGCTCTTGAAAATGAGTTTCACGACGCCGTCCCCTTTTTTCT
TCCACAGGCCGTAGCTGCCTACGAACGCTTCATCCACTGTCGTTAAACCCAGCGCGTCATATAGCGAACCATCGTCGATATCGCCAATAAATGAGGTGGG
TCCGCAAGTCGGTTGCACGAATTGGGATGCTAACCACACAAGTCTAGTTGGATCGAGACCAGACAGCATGACGAGCCCATAGTTCGTGACTTCGAGTATG
TACTGAGACTCGGCTACAAATGACCCCCCGTTGGTCACCCCCGTCGCCACGAGCTGCTCGATGATCACTCCGAAGGTTTTCCGTAGCAGGTCGCGAGTAT
CGAACGCGGCCTCCTCCGTTTTATAGGACAGTAACTCGTTCATGCAGTTGTTGGTAGCTGTGGGGATGTCCCTCAGCACGAGCGAGGACCTGCTGATTTT
CACTCGGACATCGTTAATCGTAGCTCCGGGAGTATTATTGCGAACATTGATAACCGAAGTCATAACGTGATCCGAGAGGCGTTTGAGCTGATATCCACAC
GTTGAGTTTGAATCTAAAAAGTCCTGGAGCTCCTCCACGCTACCGGTAGCATCTGTTAGATCAACAACTGCAGTGGCGTTGGTGAGAAGGTTCATGACAT
TCTTGGCGGACGAGAGGATTTCGTCGCCGTTGATGATAGCTTGCTTCACGATGGCTTCCACGATCATCATGACAATGCCGGTAAACTGCAAATTCGCCGG
CACTGGTACGCCAATACAATGACACACTGCAACTGGCAAGTCCACGAGAACGACATCAGACTGGTAGGCCACGGCTAATAGCTCTTCAACAGCTCCTTGG
GGTGCCGTCGTTTTCTGGAATCTGATGTAGTAAATGAGAGACCTGAGCACGCCAACCACGTTTGCAGCGCAGAAGAAAGTCTGGCTTACTTTCTTGTAAC
CTGAAAAAATGGCACCTAAGACGCCTGCCGTCGCCACATTAACCACTGCTGCCACCACAGCCACTGTTTTTTGCAGGATCTCCAGCGCACAGTTGTCATT
TTGAGGAATGCACTCCAAAAAACACTTCACGGGGTACGCTAGCGGACACTGAGCGATGCAGTAGTCATCGTCCAAGGTGTAGCCTGATGGACACACTTTG
CTGCTGTTGAAAAACTGCATCTGCCGGTAGCACGCTGAGTCTTTGGCAACCCCGACAGAGGGGCCTACCCAATTG