Description :
From Genome Similarity Track
Location :
Scaffold_1178:4585- 6145
Sequence
1560 bases(100 bases per row)
AGGGTTCTGATACGGCTTGAGTAAGCCAACGTAGAAGACTGGATGCGTGCGCATCTTCTTTGGAAGGTTAAGCGTATACGCTAGGCCCTTCTTGGCCACG
ACCTTGAACGGCCCTATGAACCGTGGTCTCAATTTTGTCTTAAAGACTGCAGACACTGCATGAGTAGGTAGGTTTTTGGCATTTAATAAAACTAGGTCTC
CGACCTCAAACCTTTCTTCATTGCGTCTGCCTTTGGCATCTGCATGTTCTTTTTGCATGTCTTGGCTTTCAGCCATAGCGTCGCGTACTTGACGCATTAC
GCTTAGTCTCAAAGAGACAAAGTCATCGACTTGCTTGCGAACCGCAACAGGGCTGACATCAGCTAGCCGCTCGGCTATCCCTCCCCCATCAAGCCCTGAG
CCACTGCGTGGCGGCGTCAATGGGACGCGAGAATTAACCAAGCCGTTCACATAGAACGGAGTGTAGCCTGTCGAGGCGTGCACTGCATTATTTAATGCGA
ACTCAACGAGTGGGAGCATCTGGCTCCAGCGTTTGGCGCCTCAGCGCATACGCTTCGGAGGATATCCTCCACAACGCGATTCACGCGTTCGGTTTGACCA
TCGGTCTGCGGATGGTCCGCTGTGGACATGTCCAAACGAGTGCCAAGCACTCTGAAGAGGAACGTCCAGAACTTCGCGGTGAAGCGCGGGTCTCGATCCG
AGACAATTGCCTCAGGCAAGCCGTGTTGGCGAAAGACTCGGTCTAAAAACAGCAAAGCTGTACCTCCACCATCTATGGTGTCCGGCACCACGCTAAATGA
GCCATCTTGCTCAATCGGTCTACAAAGACCACAATACCCGTGTTTCCTGCCTTGTCCTTGGGAAGGCCAAACACAAAGTCCATACTCATGGACTGCCAAC
ATCCCTTGGGGACAGGCAAACTCGCCAATGGCGCTGCCGTGCTCGGCGCGGACTTCGTCCGTTGACACGTCTCACACGTGCGTACATAGGTGCCAACCCA
CTTATACATCTTGGGCCACCAGTACATCGAGCTCACCGAGCCATAGGTCTTCTCCCGACCTAAGTGCCCGCCCACGGGCGTATCATGAACCTCATAGAGG
ATTCGATACTTTAGATCCTCATCATGAGGAACGACTACACGAGGGTTATCCTCAGAGTCGGTGCTGTAGTACAGCAGGCCGCCATCGAGCGAGTATCGAT
GCAGCCTCGCGCGTAAGCGCCCAGACAATTCCTTGTCAGAGTCTTTAAACTCTTCGCTCCCAAGAGCCCGTAGCAGCGCTACGCACATGTCGTCTTGTGC
ATACGCTCCGCGTATCAAGTCAGGCACTGACGACATCACTGTCGTGACATGAGCTAACTCGTAGTCCGGCCTGCGCGAGAGCGCATCGGCCACTACATTA
AGCCGCCCCGGCTTGTACTTCACCTCGAAGTTATACTCGGCAAAGAAGGAAAGCCATCTTGCCATTCTCTGAGAGAGATGAGGCGACTGTGTCGCAGTGC
GTAACGACGCATGATCAGTAAAGATCACAAAAGGCTTAGAGCCTAGCAGGTGTACCCTGA