Description :
From Genome Similarity Track
Location :
scaffold_39:4585- 5917
Transcript NameFunction/comments
Plaha_PHALS_15005hypothetical protein

Sequence
1332 bases(100 bases per row)
GCGGGAGCGTCTCAATCTGAAGAAGATCGCGTCGCTTTTGCGCAGAAAACGCCAGGTGGAAAACCAAATGCTTTCGAAAAGGGAGCTACGATACATTGTG
ATACATACGTACTAGACAGTATGTACACCTTTTGAACAACGCTCTTACATGTCCAGGCGTTGTAAATTAATAGCCTACCCCATCCGTATACACTTCCAGT
TCTGGCGAAATAAAAGCTTTCACTCGCATTTTCATTTTTACCTTGACATTCACATCCGTCGGAAAGCCCAATGGCTCTGCAGCAAATCGTCCTGTTTCTC
GTTTTTTCGTGCATTGTATCGGCATCAGCCATTTATCAAGGCTTCGGTACAGTTTACACGCTTACCTCGCCTTTTAACGGAAATTGCAATTTCATGCATA
CGCCTGACAGAGCAGCAACTAAGTACGCTGCACTTAATACCGAACAATGGGAAGAAACCATGAATTGTGGACGGTGCATTGAAGTTTCGTGCACTGACCC
AACATGTGCAGGCCGACCGTCGGAGGTCGTGCACATTTTGGACCAATGTCCTGGGTGTGGATATGGTGGCTTGGATCTGTCGCCAGNNNNNNNNNNGAGG
CATGAGCGCAAAAGAAGCTCGAGAGACCCTTTCCAAACAGCCTGATTTCGAAAGCCAAAAGAAATGGCTAGAGGAAACTGTAGTGGAAAATCAACCGGGT
TTGGCAAACATATTCTATCCCAAGTTCCACTGTGAGTTCAACTTCATCGAGTTATATTGGGGATACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN