Description :
From Genome Similarity Track
Location :
Scaffold_340:45837- 47761
Transcript NameFunction/comments
Phyin_T30-4PITG_21602Pro-apoptotic serine protease nma111-like protein

Sequence
1924 bases(100 bases per row)
CGCGACGGGTTTTGTGGTGGACGCGGAAAAGGGAATCATTTTGACGAACCGCCACGTCGTGGGACCTGGACCCATTGTACGGTGGTTAAAAAAGTTTTGG
ATGGCGATTTTGCTTTAGGTTGCTGACTTTATGATAATTCTTGGGGTTTGCGCGCTTGTGCAGGATGCCGAGGCTGTTTTCAGAATAATGAGGAAGTGCG
GGTGATCCCGATTTACCGAGATCCGGTTCACGACTTTGGCTTTTTCCAGTTCAACCCGGCGGTACGTTGTGTCTGCTCACTTTCCTCTTGTTTTTCTGCT
AAGTGAGCTTACACCTGATAAGCAGGATGTTAAGCACATGTCGGTGCCTTCTTTGCGTTTGGAGCCGGAAAAGGCTACCGTTGGGACGGACATCCGCGTC
GTGGGTAATGATGCTGCTGAAAAGCTCGCAATTGCTAGCGGTACACTGGCGCGTCTGGATCGCGATGCACCTAACTACGGGTACAACAGCTACAATGACT
TCAACACGTTCTACTACCAGGCGTCGTCAGGAACTACCGGCGGTTCATCCGGCTCCCCTGTGCTCAACCATGATGGTGACGCCATTGCTCTTAATGCCGG
CGGCAAGATTGGCACATCAGCTTCCTTTTATCTGCCCCTCGATCGAGTTAAGCGAGCATTCGATTTAATTCGAGAAGGTAGGGAGGTCTCTCGCGGTACT
ATTCAAGCGCTTTTCCACTACAAACCCTTCGACGAGGTGCGCCGGCTCGGTGTTAATCCCGCCACAGAAGGGCTCGTTCGCACCTCCTTCCCACTCGAGA
CAGGAATGCTGACAGTAGCTGAAACGATTCCCGGAGGCCCGTCGAGCAACAAACTGCAGCCTGGTGATGTACTGGTACGCGTCAACGGCGAATTGATCAC
GCGGTTTGTGCCATTGGAGGCCATACTCGACGACAATGTTGGCGAGGAGGTAGATATTTTATTTCTGTCTAAGTTGCTTTACCACGCTGACTCATTCCCC
GCGTTTTTCCCGTAGGTTGAGATTCAAATCGAACGCTCAGGGGAACTGATAACGCACAAGGTGCAGGTACAGGACTTGCATTTCGTTACTCCGTCGCGCT
TCATCGAAATTGGTGGTGCTGTCATCAACCCGTTGTCGTACCAGCAAGCTCGAAACCACGCGATGAGCCCTGGAGCTCCGTACGTTGCAGACCCGGGCTA
TTTCCTTCAACGTTCTCGTATTGGTCGCGGCTCCATCATTCACTCTGTAAATGGCACCAAGACACCTGATCTCGAGACACTCAAGAACTATCTGAAGCAG
TGCAAGGACCGCGATCGCATCGTGGTCAAGTTTTCGAAGTTGACCGATAAGTCTGAAAAAGTCGAGGTTGTGCATGTGGACCGCAGGTGGTTCCCGTTCT
GCGAGTATGTACGAGACGACAAGCTGGGAACATGGCATTGCGAACACTTTAGTCCTCCCAGCGAAGACGGTTCTGCACATGATGCTGAAAAGAGCAAGAC
CTCAGCCGAAGAGGAGCCGATCGGTTCAACGACTACCTTACCGGGCAAGAACCCAGTGGAAAACAAGCTTGCGCGGTCGCTAGTTACGGTGGACTTCGAC
AGACCATTTAGCGTGAACAGTTTATCGACGTCGAATTACCGAGGCACAGGGCTTGTGATCGATGCGGCGAAAGGGCTAGTGGTTGTAGACCGCAACACAG
TGACCGACTCAATGGGCGATGCCATGGTGACTTTCGCCAGCACCATCATGGTTCCGGCTCAAGTGGTATTTGTCCATCCGGTGCATAACTTCGCCATTGT
GCAGTACGATCCGAAGCTCATTGGGTCCACGCCCATTGAAAGCTGTCAGGTGGCTTCTAAACCGCTGGTGCCATCCGATCCTGTGTGGCTTGTTGGTCTC
ATGAGCAGTGTGGGTCGTAGTGGC