Description :
From Genome Similarity Track
Location :
Scaffold_55:45835- 47332
Transcript NameFunction/comments
Phyca_LT1534510189glucose transporter, putative

Sequence
1497 bases(100 bases per row)
ctcactttccaattgaccaagccgaccccaagtcaaccaagtcaagtcaagtgaaaatggccgactacacggaagcctccacccccaaagccgagggcgt
gaccgccttcgacgaggccaacaaggccgccgcgcgtctcatcaagcccaagacgatcctgtacacgagtgctctgctgtcgtggctgcagccgttccag
agcggttggtccacctcgcagatgaacctgtcgcagtacaacgacacggatgagtgcaatgctcgtcccgtggcggaggacacgtgcctcatgttccctg
gccactcgaagctggagtggacgttcgccgtgaacgcctggatcttcggcgccatggtgggttcgctgtgctgcggctacttcagtgacaagtacggccg
taagaaggctctgatgggcaactgtatcttcatgatcgtcggtggtgtggtgcaggcgtccgtgtcgaacatttggatcttcgctctgggccgtcttatc
gccggtatctcgtccggtacggccacggccaccattggcggctacatcaacgagctgtcgcccccgcacatgcgtaacactctgggcctgggccttcaga
tcttcacgacgatcggtattttggtgccggccatcgcgttcttcttcgccaacacgagctctggctggcgttacctggctgcgttccccgtggtgctggc
cgcgatctacctgcttctggcgccgaccatgtgcgtggagagccctgcgtggctgctgacccagggccgcaaggacgaggccaaggaggtgatcgctcgt
ctgtacggcgaggagcacgtgcagacggctctgtcgtggctggaggtgagcaagaaggctgagaacgccgaggagggcctggccgctcccaagaaggagt
cgatgttcgcgcctcgttaccgcatgcagcttctgggcggtatcttgctgtcgtgcgctcagcagctttcgggtatcaacgccgtgttctactactccgg
taacatcttctcggacgccggtatctcggactcgcgcgtgggtacgctcatcatcgacttcatcaacatctggcccgctttcttcacgggtgtgctggcc
aaccgcttcggtgctcgcaacatgatcctgtggggtctggccggtatggtggtcatgtccctgggtatgacggtggcgttcatcgtggacgtgtctgctc
tgtcgattgtgttcaccgccctgtacgtgatcgtgttcggcgtgacgctgggcccgctcgtgtgggtgatgacggccgacatcttcccggactcgatccg
tgccagcgcgtcgtcgctgtgcatcggcatcaactggctgtgcaacctcatcgtgggtgtgtcgtacccgtacgtgtcggacgctctggacgactacgcg
tacatgccgttcgtggtgcttcttgctctgttctacctgctggccctgaagctggtgccggagacgtcgggcaagtcggccgaggagatccaggccg