Description :
From Genome Similarity Track
Location :
Scaffold_86:45831- 47580
Transcript NameFunction/comments
g7095.t1hypothetical protein

Sequence
1749 bases(100 bases per row)
CGCGCCTACCAACTACTGACAGTTGACAATTTCGATGCCGAGCCTCGTTCAGATGAGGGACGTCGCCGCTTGCGTTTCTTCGCTAATTCGCTCTTCATGG
ATATGCCTGATGCCAAGCACATTCGCAAAATTCGTTCACTGACGGTGTCGACACCATACTACAATGAAATTGTCTTGTACTCGATCAAGGATTTGACGGC
ACAGAACGATGACAGCATCAAGCTGTTGTACTACCTGAAAACCATCTATCCATTCGAGTGGGAGAATCTGCTCGAGCGACTGCAGGCCAAGGACATGGAA
GAGGCCCTAAAGAAGTTCCCGGAGGAGGTTCAGCTGTGGGCCAGCTACCGTGGTCAGACTTTGGCGCGTACTGTACGCGGTATGATGTACAATGAAGACG
CCATTCGGTTCCTTCACTGGTTGGAGATTTGTGAAAACGAAGTGATGCACCAGTTTGGATGTCCGTGCAACAAGTGTAAGCGATTGGACGAGATGGTTGC
CCTGAAGTTCAACTACATATGCACGTGCCAAATCTACGGTAAGCAGAAGGATGAACAGCGTCAGCAGGCGTCTGATTTGGAATATCTGCTTCGCAAGCAC
CCGACCCTGCGGGTTGCCTACGTCGATGGCCCCAAGAAGATGAAGGAGGGCCCGCCAAAGTTCTTTTCTGTCTTAGTGCGAGCTGACAGTGAAAACATTG
CTGAGGTCTACCGAGTGGAGCTACCAGGCAACCCGATCATTGGTGAAGGTAAGCCTGAAAACCAGAACCACGCTATTATCTTCTCGCGCGGTGAGCTACT
GCAGTGTATCGATATGAATCAAGACGGTTACCTTGAGGAGGCTCTCAAGATGCCGAACCTGCTGTCAACGAAGGACAGCGAGACTGCTAAGTGTCCTCTG
ACGATTATTGGTTTCCGTGAGCACGTGTTCACGGGCGGTGTTTCGAACCTGGCCAGCTTCATGTCGATCCAAGAACTGTCGTTCGTATCGCTTGGCCAGC
GTATGCTGGCGATGAACCACGTGCGTCAGCACTACGGTCACCCCGATATCTTCGACAAGCTCTTTGCCATGGGTTGCGGTGGTACTGCCAAGGCTTCCAA
GGGTGTGAACCTTTCGGAAGATATTTTCGCTGGTTTTAACTCTACTCTCCGTGGCGGCCGTATTTCTCACGAGGAGTTCATCCAGGTCGGCAAGGGTCGT
GATGTTGGTATGCAGCAGTTGGCTCTGTTCGAGGCGAAGCTGTCGTCGGGTGCCGGCGAGTGTGTGATTTCCCGTGATGCGATGCGTATGGCATCTCGTC
TGGATTTCTTCCGTCTGCATTCGTGGTTCTACGGTAACTTGGGTTGGTACTTCACGCAGACGATGACGGTGGTGGGTGTGTACTTCTTCATCTACGGCAA
GGTGTACATGGCTCTGAGTGGCATGGACAGCTTCTTCCTTGAGAAGGGTGGTCTTGGTATCGGCGGCACGCTTAATACGTCATGGGCGTTCCAGTTCGGT
TTCTTGTTGGTGGTGCCTGTTGTCGCCGTTGTTGGTGTGGAGCAGGGTTTCCGTCATGGTTTCACCTATTTGGTGTGGAACATCATGACTCTTGGTCCTC
TGTTCTTCACGTTCCAGATGGGTACGCGTATGCACTACTTCGACCGCACGCTGATTCACGGTGGTGCTAAGTACCGTGCGACGGGTCGTGGTTTCACGAT
CAAACACGAGAAGTTTGCGGAGCTCTACCGCTTCTACGCATTCAGCCAC