Description :
From Genome Similarity Track
Location :
Scaffold_863:4583- 7103
Sequence
2520 bases(100 bases per row)
TTGCTAGACACGAGGAACCTACCTCTAGACACTGTTAGCTCTGTCGGCAGCAACAAACTGAAGCACCGCTTCGTCGGACCTTTTGCAGTCCTGGCCAGAC
ATGGTGCGTCGTACACCATCGACCTTCCAAAGTCAATGACGACGCACCCGACGTTTCTATGTCGGACGTCTTAAGCGGTACTTTGACCCGCAGGGGGTTG
CTGACTCGCAGTCCCCCCTTGACCCAGCTCCTCAAAGCGAGGGCCGGTCACAGTCGTCGACGAGGGCGTCGGAGCAAACACCCAAGCCTCGGTCGGGACG
GCAAGGCTGCGGTCAAGACCGTACGCCGGAGGGGCTCCATACGAACGGACCCCGGCGCCATACGCCGAGTACGCTGAGTACGCCGGGTACGCACCATACG
CGTACGTCTGGGAGTGTGCCGCAGGCGGCTCCGGACGTGGCAACAAAGTCTCGATCTGTCGGATCATGCGATAGGCCTCGTCCAGATCAGACGAAGAGGC
CCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATA
TTGAGATCAGCGTAGTTGCTGGTGTATTGGGCGTCTCGGCCAGAAGCCTTCGGAGATGGTACCATCTCTTCAAGACAACAGGAAATGTCGACGACACCCC
AAAGAATGAGCGGTCATCTAAATGGCCGATTGAACAAAACCAGAAATAATGATGTCACCCAGCCATTGAAGCAGCAGCTCTAGATCGTGAAGTAGCAGAA
GTAGCTCCAGCTTTTCGACCAATTAAGAAAAGATAAGATAAATATCTGGGGAAAATTCATTTTTAAATGGCAATTAAAACGTCCGCTTTTTAAAATTAAT
TTCAAAATACCGGTACGTCCTAATGACTACCGTCTTCACTCTCAATAGAAGTCCTGTGACGGGTCACATAGCACCTTGCGCTAGAGAAAGCGCACGACTT
CGAAGTCTCCACTCCGCGAGGAGAGGTAGACTGGGTACCCCTATCGAAACCTCTTGGGTTCCTCGGATGAAGAGGAAGAGGAGGAGGAGGGTACTATCCA
TAAGCTGCGGAGATCACGAACGACCTCGATCAGCAGCAGGAGTGTAACGAAGTACGTAGCCCTAAGTGTACCCTGGTTTACATGAAGTGTGACACTCCAC
ACTTCAGGAGTATGACACGTCATACTCCGGGATATTTGGTACAAGGTACCAAGGTCATTCAAAAGCAACCATTGGTTAAATGACATTGCATTTCTATAGG
TAACTAATAGTTTGTATTAAACCCAAACTTAATGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCTGGATCCAACTTACCAACTGCGCCCAGACAC
CGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTTGCTCTCTCGGTAACTTC
CGAAGTGTTCAAGTGGTGAA