Description :
From Genome Similarity Track
Location :
scaffold_1030:4583- 5932
Sequence
1349 bases(100 bases per row)
TGGCCCTTTGTCGAACTCGTACAACAACGCTCCGTAGCTTAGCCGTGACACGGAAACCCATTCAGGATCGGCATAACGATTCCACTTGACGAGATATTCT
CTGGATCGCTTGGATTTGCGGTTCGTTTCACCCATCGTATATCCTGAATGCTCTCCGCTTCGTATTCGTTATTCGCGTTATCAGGTTCCCAACTGTCCTC
AGGTAATAGCGCTGCGTCCATCATCATCTTCGACTTCAATCTCGAATATGGGCCTTTTTGGAAAATAGCCCTCGGTTTGAGTCGACTGATGTGCACCCAA
GGGTTTACTCGGTATCCCGAGTCCTCGACCTTGAGATTCACTCGAAAATCATCTCGGACTTCCTCAATTCGGAATGGTCCACGCCACATGTGTGCCAGTT
TCCGGCTCAATCCAGGTTGGATCTTCGAGATGTAAAGCCAAACGGCATCTCCCTTCTCCAAAACTGCCTTCAGGCGATCAGATAACTTACGCCTCTTTCG
GGTTTGATCTTCAGAACACGCGCTTCGCTTTTCGCTGAAGCTCTTCTGCACAAGCTAAGGCATAGCTGTAATATCTCTGAAGCTTTCGTCGCCATTCATG
AGCAGTTCGCTCAGGCATAGTTGAAGGCTTGGATCCCAACATTGCAGACATAGTTCCTTGGGCGTCCCATCCGTGGGCGAGATAGAACGGGGTGTCCAGG
CGAGTCGCGTCGAAGGACGTATTCAGGGGAAACATCAGCCTTTCGGTGTATTAGTCCCAGTCAGATCGATCAACCTCCGCAACATACACCTCGACACTCC
GTATGACAGTCTGTACAGAACGTTCTTGTTGACCGCTCGCTTGGGGTCGACACGCGAGAGTCGCTCTCTGCTTACTCCTTATGAGATCTCGGAACCTCGT
GAAGACCTCGCTCATGAAGCGAGCATCCTGGTCATGCTGAATTACCGAGGATGACCCGAATCTCCGAAAAACGGACTCTTCGTACGCTTCAGCGACATCT
TGGACAGTTGTTGACGACATTGGCTTACACATCCCATAACCCGAGAACATATCTTGGAACAGTAGTAGGAACGTGTTCCCTCGGACTGACTCCGGCAGAT
GGGTCACGAAATCCATCGAGACAGCCTCAAATGATCGTGTTGGCTCGATATGTTCCAGCGTTCGGGGGTGCCCCTTCACGCTAGCACAACCGATACCTTC
TTTCACGAACCGTTCCACGTCAGCATACATGCCTGGCCAGTAGAACCCTAAGCGCAATTCCTCGTGGGTATACCTTGGTACCCACCCTGAAAATCTTCAT
GCGCGTAGTGCAGCATGTCTTCTCGGAGAGATTCCATGACCACAATCCT