Description :
From Genome Similarity Track
Location :
Scaffold_610:4582- 7910
Sequence
3328 bases(100 bases per row)
CTACTCACGCCTTTCCAATCTCGTCTTCTCAGCGTCGATCCAGCACTCACTTTTCGAACTTCTGGAAGCAGCGCAAAAAGCGCCGATCTCGATTCGGAGC
GCGTTGGAAAACCTTCCTCAAAACCATCCTAGCGAGGATGATCGCTGGCCATTGTGATTTGGACATCATGATCGATCCGTTCTTTTTACATTTCCCTCGC
CCGCACAAATCCCTTGTCTGGTACCCCGGGTTAGGAAGAACTACAGATCCTGCTAGTTTGATCGAGGCACTCGAGATCGCGGATCGTGAGGAACCTTGGC
GTCTTCACTTTCGCCACACGATTCAACATCACTCGGGTACGTTGCTCCCACGCATCCGCAACAAATGCACACTGGTTAATCCAGAGTAATATCATATCAA
CGTCTGGTCATAGCACTCCACCATTGTTAATAGAATTGTCAGTTCAACTTCAATCATACGTCTTCTTCTCAATCTGTTCTCATCATCTTACTTTCAATAC
CCACAGGTAAGCTGGTAATTCCTTCAAATTCTCATGCACACATAAAACAACCCCATCCTCCGGCATATGCTACCCCCTAGCACACCCTTCACTCCCTCAT
AGGGCTCTTCTGATACACCCTCGTGCGATTGCATCATTTCGAAACGACTTCGACTTACTCGATCCCTTTCAAACTCTTGCAAAAGAGCTCCACAGTCAGG
TCAGCTTCGTCCACCCAACTCGGATCGGGATATCCTTTTCATTTTACCAGAAATTGACGGTGTATTCGCCCATAGCGAGTTTTCCGGCCAGATATCAAAT
CTACTATCCGCTTTACCTCAACTCGCCTTCGTCGAGATCGCCTTCCCAGCTATCCTCTGGTAGTAACGCTTCGTCAAAGTCAAAACGATTCTCTTCTTCC
ACCATCACTTTCTCTTTGGTCGTTCAGGGAAAACTCGCAGCCGTCTCAGCTTTGACAAATGTACGATCGGAAACAGTCGATAGGAGGTGTCGGCGATCTC
CAGTCGTACCGCGTGATCACTACACATCTCCGCCACCCGAAAAGTCCCATGCCACATGTGCGCCAATTTTCTCGCATACCCTTCTTTTACTCGATCCAGA
TATAACCACACCTGCGAACCCACTTCGATCCCGTGTTGATCCAGATCCTCATTGTGTCGATCTGCTCGTTCTCGGATTGAAGCTTTCAATCGTCCATTCA
CCTCTTTTCTTGCTCGTTGGTCATGTCTCTGTATGCAATATCGCCATCCTTTCGGGGCGATCTCGTGCTCCGGTATTTCCCACCGCCAATGTAGCTTCTA
GTGTAGATCGCGGGTCCCATTTGTGGATCAGATAGAAAGGTGTCTCCCCTCGAATCCGATCTTGAGCCGTATTCATTGCGAATGTGAGGCGTTCCGCGTA
CTCATCCCAGCCCTGTTGGTTGATATCTGAGACATACATCTTGAGTGAACGTGTCAGCGTTTGCACCATACGTTCTGCCGTTCCGTTGGCTTGGGGTCGA
TATGCCATTGTACCTGCCCCACGATCCGATTGAACACGCGAAAGAAATCGGACATGAATCCTGGTTCTCGATCATGTCTTATAGCTTCACTCTTCCCGAA
ACGGCGAAACACACATTCTTCATAGTTTCCCGCAATCGTCTGCGCCGTTCGGGATGAGCAAGCTCTCGCGATAACATACCCTGAAAAGAGATCGACCCAG
ATAAGTAGCTCTGTATTCCCTTTGCAGGATTTCGGCAGCGACGGAATGTGGTCCACGGCTATGATCTGGAAAGGGTAGGTCGCTTGTAGATTGCCGGGCG
ACTTTCCTTGGATCATCGGGCACCCTTTTACTGTCTCGCAGTCCGTACATTCTCCCAGCGTACAACGGTACGCTCCGATATAATCCTCTCCAGTGGAAAC
GTGATCTGATCCGCTGGTAAGTCCGGCTGATCCCTTGGTGGCCTCTCTCCAGTCTGGCGTGATAATGACGCAAGAAGTCTTGTTGTAATTTCTCCAGTAT
TACTAGACGCACCAAACCTTCTCGATCTTCTGTCTCTCTTTTCGCTATCGGACAGAAAAACAGCAGATCGTTCTCGCCAATCTCATAGTCCGGAGAGATC
TTAGCGCATGTCTTCGCTTCGTCTGAACTCAGATTAGATACATCGCCCACTAGATATTTCTTCAGGTTGACGATCCAGAGTTTCTCCTCTTGGGCTTGGC
GAATTCGTTCGCTTCTTATTCTCTGCACCAGTGCTTCTTGTAGGATATCAGGCGGATGACGTCTCTTCTGCAACGATCTCGTAATTACAGTAATCTTAGC
GATAATATCGCCCTGCCTTGGTTTTAACAGTTCGTCCAAGCGGTTCAGAGTAACCAGATCTCGGCGATCTTCTTCGGTCATTATGACTGTCTTTTTTTCC
TTTTGTAAATCTGTACTGGCCAGCCGATCTGCACTTTGGTTCCAATCCCACTTCATATGCAGGAACTCATGGATCGGCCAGGATCAAAGATTCTCTAGCG
CCCGATGTCGTAAAAGTTGGAGGCCGGGCGCTTTGCAATCGGTCTCACCTCGCATCTGCTGGATGACCAGGTTGGAGTCGCCGCATATAATAACTCGCCC
CCGGTCCAGATCGGCAAGCAAGTCGAAGCATAAAAGCATTCCATTATATTCAGCTTCATTCTCCGTGGAATCGGTCACGAATCTGGATTCCACCGACACA
CACGATCGTCCATTCTGGGAGCTACCATAGGACCGCTCTATATATACCCCCTCTTTTCTTGGAATTCTTGCCGACCCATCGAAGCTGGCTACTATTAGAC
TTCCGCCTTCTTCTAAAGTCGGTGGAGGCATAATTATCTTATGCCGAAAATCTTTTCGTGGAGCGATTACGATCAACACCTCTTCGATCTCTTCACGCGG
GGTTTATGCTGGCTACTAACGCTCCCAGGATCTTGTCTTCTCCTTTTTTGCATCTCTTCACTTCCTTGGTCCAGTTCGATAGCAAAGTAGCCCAACGTCC
TAAGTTCCATTGAAACCTCGAGATACATCAGCCATGCCAAGGTCGAATGTCGTGTCAGTACTATCAGTTCTCTTGAGACTAGCATAGTATAACGCACGTC
CAAGATGCGAAGTAGTGCCAATATTTCCTTCTCTACTGTCCCATAGTTGAGTTCGTTCGCCTTCAGCGTTCGACTGGTGAAAGTAACTGGCCAATACACG
CCATCATACTCTTGCATCAGGGTAGCTGAGACCGCCCACTTGCAGGCATAAACCACAATCACTGGAGGGCGATCTGGGTCAAAATGTCTCAGCGTCGGGG
TTTTAGCTATTTTCGTCTTCAACATAGT