Description :
From Genome Similarity Track
Location :
Scaffold_992:4582- 5934
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_992-snap-gene-0.6Phosphatidylserine synthase

Sequence
1352 bases(100 bases per row)
GCCCACTGCGTGGTCAGGAGCAGCAGCGGCGTGAACGAGAGCCAAAAGAGCACATCGAGTTTGCCCCACGTGGTGACCTGGTAGAGCTTCGCGATGCGTG
GTGATGCATGCTTTGGGGTCGCATTCCGTTGGCTGGCAGATGAAAAGAAGCACACCATCCAGATCGAGAACATGGCCACGAACGCCAGAATCGGGTACAG
CACGAACGCCGGCGGTGCGTCGTTGAAGAGCACACCGTTGGCCGAGAATTTTACCCACACGAGCACCTCAAATACCGCGATCGAGAGGATCATCCACGCG
TTTTGGCCTAGACGCTGGCACTCCGGGTTACTCAGGAATTCGTAGTACTAGGAGCAGATACGAGCACACAAAAAGAGATTCTGGTTAGCACAAACGCATT
TCAAAAGGGCACATTCAAAATAGCCGCTTGCTTACCTCGGCTGCGCCTGGGATGCCAATGAGGAACACGAGCGACAAGCGGTAGGCGTTGAAGTTGCTCT
CTTTCGGGATGCTCAGCGTGTTCAGCAGGAAGAACGCGTTCAACTCCACGAGCAGACACACGAAGAGCGCAAACATGATCTACAATCAGACAAAAAGACA
CAAGTGTCAAACGCCAGTAAACTTAGGCTCAACGACGTCAAGCCTGGAAACGTACTTGGGCAAAGCGCTTAAAGCTTGAGAACACTTCCCAGTGGTATTG
CGACCAGCTGATCGGCGTGAACTGGCTGAGCACCAGGAGCATGTAGCCCATTTTCTTCTCCTTCTTGCCCGACCAGTCGTACTCCTTGGTCTCAAAGTAC
CAGAGCGTGAGGCGTCCCAGGAACATACCCAGTAGGTTGGCGCCAAGGAGGTCCATGAAGAGCGAGTCCCACCAGCACTCTTGGAAATCCGGGATTACAA
ACTGGAACGCGAGCTCCAGAATCTCGAACGCGATACTGAGCACCCAGCAGAAGCGCCAGTCGCGGAACATGCACATCTTGCCCCACCACCCGGTCACGTG
CGCAAGGAACCAGATGCTCGACACGCCACGGTATATCGTGTTGGAGTTGATGTCGCACTCCAGCGGCGCGCCTGGAGCCGCTTTCTTCATGGACCCGACC
TCGGGAAAGAGAAACTGCATCGACAGGATCGCGCCCTGGCGGTTTTGCACCGACATGGCTGCAAGCAGAAGCAGGTACACGACCGAGCAGCCATGCACGA
TACGCCAAAGTCCAGGATGGGGCCGCACCTACTCATATGGAGACAGCATAATATGCAGGTTAGACGCCATTCGTGTTTATGACTATACCCAACGACGTAC
CATGAGCCCATCGCGCGTCTGCAGGAAGCAGTAGACGAGGAAGATCAGCACG