Description :
From Genome Similarity Track
Location :
Scaffold_16:45816- 50350
Transcript NameFunction/comments
Phyra_76056callose synthase, putative
Phyra_76057unnamed protein product

Sequence
4534 bases(100 bases per row)
GGAGTTCATCCAGGTCGGCAAGGGTCGTGATGTTGGTATGCAGCAGTTGGCTCTGTTCGAGGCGAAGCTGTCGTCGGGTGCCGGCGAGTGTGTGATTTCC
CGTGATGCGATGCGTATGGCATCTCGTCTGGATTTCTTCCGTCTGCATTCGTGGTTCTACGGTAACTTGGGTTGGTACTTCACGCAGACGATGACGGTGG
TGGGTGTGTACTTCTTCATCTACGGCAAGGTGTACATGGCTCTGAGTGGCATGGACAGCTTCTTCCTTGAGAAGGGTGGTCTTGGTATCGGCGGCACGCT
TAATACGTCATGGGCGTTCCAGTTCGGTTTCTTGTTGGTGGTGCCTGTTGTCGCCGTTGTTGGTGTGGAGCAGGGTTTCCGTCATGGTTTCACCTATTTG
GTGTGGAACATCATGACTCTTGGTCCTCTGTTCTTCACGTTCCAGATGGGTACGCGTATGCACTACTTCGACCGCACGCTGATTCACGGTGGTGCTAAGT
ACCGTGCGACGGGTCGTGGTTTCACGATCAAACACGAGAAGTTTGCGGAGCTCTACCGCTTCTACGCATTCAGCCACTTCTACCGCGCGGTGGAGCTTGT
GTTCTTGCTAATCCTGTTCCGAGCGTACGGCACGTTCTCGTGGTGCAACTGCTCGTGGACGCAGGATGCTTTGTTCTATAACTATTACAAGCCCTCGGAC
AACGACTGGAACACGCGGTGCTACGCCAACTACTACCAGACGTGCGTTGAGCCGACCAATCAGAACTACGGCGTTATGTCGTACTCTCTGTGGATTATCG
CAGGAACGTGGTTGTGGGCACCGTTCTTCTTCAACCCCAGCGGCTTTGACTGGGACAAGCTGATTGAGGACTACAACGACTGGCAGAACTGGCTGAAGAC
AACGAATGACTCGGCCGCAAGTTGGTCGGGTTGGTGGTCGAACGAGGTGGAGTACCTGGAGCACTCGACGAGGGGCGCCCGCATTGTGTCGATGATTCGT
AAGATGCGCTTCTTCTTCGTCGCCTATGGTATGTACCTCCAGCTGGCGTACAAGACGTACTACGAGGACCAGGATCTCGAGATTGAGAAGGGCTCCATGA
TTTCCTACGCGCTTTCGGGTCTCATGTTCATCCTGGTGCTGCTGCTGCTGTGTTGTGGCTACATGGCCAGCCGAATCAAGAAGAAAATGACCTTCAAGCA
GAAGAAGCTGCGCAAGATGAAGTTCGTGCTGTCTTGCTGCGGCCTCCTCGTGGCATGCGCTTGCCTGCTGGTCCTCTCGATCATTAACCTGATTGAGATC
GGCATCATCATCTTGATCGCCGCGTACTGGTTCCTGCAGCTTTGCATGTACCGCAACCAGACGAGTCACGTCGTGGTGCGCGCGATGGCGCGGTCGTACG
ACCGGTGGGTGGGCTGGATCATTTTCGGCCCAGTGCTCTTCATCGCCATGTTCCTGCCGTTCTTGTCGTCCTTCCAGCAGCGCGTCATGTTCAACAACGC
GTTCACGTCGGGCCTCGAGGTGTCCAAGCTGTTTGCGAACGAGGCGGCGTCGTCCACGAGTAAGATCGTCAAGGTCAAGCGCGTGGCCAAGAAGAAGAAG
CGAAGTGACTAGAGCTAGCGAGTCGTATCACGTGCTCCAGCTGAGCGGTTGGTGTGCCGCCCTCCGAGGAGATTGCTTTTGCACTTTGGACCATTCTTCG
GCGCTCATGGCGTACGCGGAGGGATCCCTATGCCGGCACTCCTTTTTATCGCTGCTGCTTTTTGTATTTGAGCACTACTGTATCCAGTAACTCCTAGCAA
AATACACATGGTCATGATGAACATGCATAAGATAAAGTCGCGCCGTTCATAACTCTCATCACGAAACGAGGACAGGCAAGAAGATCGCGAGAGCCGACGG
ACGGTCTCAGCAAGGCCCATCTTCGCTCGCGACGACGAGGCACCCGGCGCGAAGCAGAAGTTCTGCTCGCTGCTACAGTAAACTCGTTATCCCTATACGA
TCGACAGCGCAGGGCAGGTCGGAAGGTCTGGTGACGCCGAGTTGGTTGCTTGTCGTGGAGGTCCGACTCGAAAGAGTTCAGTTTTTGACACGTAGCGGTT
AAGTGGTTAAGAACGGCGTAATAATTGTCTCAGCGACTGGCATACAAAAATCCTGTTGCTCGACACTTGGCTACATTTTTTTCAATCGTCCATCAAAAAA
TGCCCGCGTCGGAGCAACGCTGCGCTCCTCAGTAGTGAGGTCCCATGATAAATAGCTGCTGCCCTCCGCTATTCTCCAGAGAGTGTGTTGTCGTATGGCC
AGCGACCACCACATGTGCGGCCGTTTTCTCTCTGCCCAGCCTACACTTGACTGCGTGGGATAAACTCTCAAAGCTGAAAAGACCGGCTATACTTGTGGCG
GCCCGAGGCGTAACGGATGACGCTCACACACCGAAGCGCCTTTCACCGCGCCAGAAGTGCCAGCATCAACGCCGCACTCAGCTGGCGCTGGCGTATGATC
TTGCGGCGCGGCCTGGGGCTTCGGAACCGCTCCCGACCAGTCTCTGCATGCCAGCAGGAAGCAAAGTAGTATCCCCAGCAAAATAGTACTTTAAATAGTG
CTAGAATCCAGTTCAATACTGGATTCTGAAGCAACTGACTCGATTAAGTACGATAGTACTTTGAGAGTAGAACTGAACTGGCTTGTTCTTGTAGCGATCC
GAAACTTCTCGTTCACTTGATTCCAGTATGCAGCAGCTCGCTCAGGGTGTAGGGGAGTCGTTTCTGGCCGAGGTCCGCGCAGCCCAATTCTCTCCCCTCA
TTTACCTATCGTCTCGCTCGAGCGCGCTCACAAGGGGGCGGCGTTAGAACCTTGTCGTGCAGCTCGAGAGACGCTTGAAAGGATGAACCGCCGCGGCCTA
GGCAACGGCAACGGCAGCAACAGCGAGCGCGAGGGCAGCTCCGTGGGGATCATGACGGAGGCGCTGGAGATGCAGCGCCAGATGTGCGACGAGGCCATGG
GCCTCGTGAACGCCGGCGTGGCCATGCAGAACGCGACGCCCCCCAACGTGGCCGAGGCCGAGCGCAAGCTCACGCGCGCCGTGGACATCATGGAGCAGGC
CCTGAGCATCCGCTACCGCTCGGCGGACGAGAAGGACGCGGCCGACCGCCTCAACAACAAGATGATGCGCTACGTGAAGATGATCAAGAGCCAGCGAGCC
AAGAGCGTTGGCGGCAGCGGCCCCAAGGGGCGCAACCTCATCAAGCACAACATCCTCGAGATGGAGCGCCTGCCGGAGGTGTACGCACCCGTGCTGCAAC
TGCTCAACAACTCGAACCAAGTCGGGGACATTTGCGAGACGCTTAAACGCGCGTTCGGCTTCCAGGAGAGCAGCATACTCAACCAGAAGGAGCACCTGCT
GCTGCTGCTCACCAACTTCAAGGAGCAGAGCGGCCAGGACGACGGCAAAAAGAAGAAGAAGAAGAAGGACGACACGGAGACGATCGACGACTATTTGCGG
CAGCGTGACCCGCAGCTTGAGCTGGACCTGGCCAGCAAGGGCATTGCGCGACTGCACGCACGCGTGTTCGCCAACTACAAGAAGTGGTGCAAGTATGTGT
CACAGAAGCCCAAGTTCTCGAACGACCCGCTCGTCGATGTTTCGCTGTTTTTCCTCATCTGGGGCGAAGCCGCCAACTTCCGACAGATGCCCGAGTGCCT
GTGCTTCCTGCTGCACACAATGCTACCCAAGGTGAACAGCGGCGGCAACGAGGAGCCCGGCACGTTCCTCGCCAACACGATCCGCCCCATGTACGCCGAG
TTGCGTCGCGATAACGACAAGAAGACGAGCAAGGGCGCGCGCGCCGCTCACCGCGACATTCGCAACTACGATGACTTCAACGAGTTCTTCTGGACCAAGA
AGAGCCTCAAGTACGACTACACCACTATTGGCGAGGCATTCGCCAATTACGACAAGAAGGGACGCCCGAAGATTGTCAAGAAGACGTACAACGAGACGAG
AAGCTGGATGCGCGCCATCATTTCGTTCCGACGCATCTTCTTTATGAACTGTGCGCTGTTCCTGGCCACGTTAGGTTTCTCGATCGATATGGTGCTGTTC
TGCCCTGACTCGACTATTATGTACGGTCAGGACGTGCAACCGTCTTCTGCCACGGACGTTCTGACCATCTTGGGCAAGAAGTACGCGGCGTCAACGGACT
CTTCATCAGTGGAAAACACGGACGATTCTCTTTCCAGTGACATCAATACGGACAGTGGCGCTGGTTCGCAGTGTTTGTACGCCAAGCTAGCGACATGCCT
GGGCGTGGATTACTTTTCGTCAGCTTCGGATACTTTCGGCACGCTGCCTCAGGATTTCAAGGAGCTTCTGGAAATTGTGCCTTTTACTGACTGTGTTGAA
AAGCAAGTGGGTCGATGCTCGTGCTACCATGACCTTATCGATACCTGCTTTACCGACACGGGCGACGCGGACGAAGTGTCGACCGCTGGCTCAGTGGCGT
CGCTCACGTACGACCAGAGCCTGTGTGCCCCCAC