Description :
From Genome Similarity Track
Location :
Scaffold_137:45810- 48884
Transcript NameFunction/comments
Hyaar_Emoy2810786phospholipidtransporting ATPase putative

Sequence
3074 bases(100 bases per row)
CTTTTGCTCGAACGTCGTGATCACGTCCAAGTACACGACGTGGAACTTCCTCCCGCGGTTCCTGCTCGAGAGTTTCCGGAAATTGGCCAACGCCTATTTC
CTCCTCGTCTCCATCCTGCAGTGCATCCGCAGCATCAGTAACACTAACGGGGTGCCCACGACGCTCCCCGTGCTCATGATGATCCTCACAGTGGACGCCG
TACTCGCAATCATTGAAGACCGACGACGGCACGTTGCTGATGAACTAGCCAATTCCGCCCAGTGTCACGTGCTAAAAGAGTCGTTTACCGGCTCTCGAGA
TGCCATGACTCTTAGTGAAGATACGACACCGGACGTGGCAGAAATCCAATGGGCAGACCTCACGGTTGGCTCCGTGGTGAAACTTTATAATCGAGAGATG
GCACCGGCGGACTTGCTGATTCTTGCTGTGGCGGAGCCGAAACCGGCGGAACCGGCAGGTATTTGTTACGTGGAAACCAAGAGTCTCGATGGCGAGACGA
ACCTCAAGCTGCGGCACGCTTGTGACGCGACAATGCACGTGCAGACAGCAGCCCAAGTGGCGGCACTCTCGGGGCAGCTTCGGTGTGAGAACCCGAACAA
AGCTATTGGTCGCTTTGATGGCACGTTGCTCGTGACAGGAGGTGGTAAAGTAGCTGCAGTCACGGACTTGCAACCGCAGCCAATTGCAATGAAGAACGTG
CTGCTGCGTGGCTGTCAATTGCGCAACACGGACTGGATCTACGGTCTTGTGGTGAACACGGGGCCGGACACGAAGATCATGCAAAGTGCGACTGCTGCAC
GGCCCAAGTGGAGCTCCATCAATGAGACCGTGAACAAGATGATCATCTGGCTCTTTTTGCTGCTTTGTCTCTTTTGCGCTGTGTCTGCGACGCTGCAAGT
GATTTGGCTCGATAACCACGTTGATGAGAGCTGGTACTTGAGCTGGTCGCCTGGTCTGGCGAGTCAGTGGTTTGTCGGATTTGGCTACTACTTTTTGCTC
ATGTACCAAATGATTCCAGTATCACTGTACGTGACGATCTCGGTGGTCATGTTTATTCAGGCAATCTTTATGACATGGGATGTCGACATGTACTACGAGG
CAACAGACGTGCGCATGATTGTGCGCTCGTTGGGATTGAACGAAGAGCTGGGCCAGATTTCTTATGTGTTTAGCGACAAGACTGGCACGCTGACGTGCAA
TGTTATGGAATTCCGCAAATGCTCGATCAATGGTGTGTCATACGGGACTGGAACGACCGAGATTGGGCGCGCGGCACTGCGCCGAAAGGGTGTGGCTGTG
CCCACCGACACAGAATCGATTCCATCACTGCGTCGTGCCAGTATCCCGTACGTTAACTTTGAAGACGCGCGGTTGTTTAACGCACTGGAGCGACCGATGG
CGGACGACTCGCCAAATCGTGAAGCCGAGTTTTTCTTGCATTTGAGTCTATGTCAAACGGTCATTCCGGAGACTGTCGAAGGTAGTTCTGAAGTGCGTTT
TTCGGCCTCTTCACCCGATGAACAGGCGCTGGTTTCAGGCGCCAAGTTCTTTGGCTTTAGTTTCGAATCTCGTGGTCTCGGCGTCGCTCGTATACGAGTG
AAACGTCCGGACTTGATTCGTCGCTATGCCAATGGTTATCTCGGTTCGAACGCTTTGCTGGAGTTTAAGATCCTGGATGTTTTGGAGTTTACTAGTGATC
GCAAGCGGATGTCTGTTGTAGTGCAGTATCCCAATGGAGAGTACTGGGTGCTCACGAAGGGAGCTGACAATGTGATTTTTCCGATGCTAGCTAAGAACAA
GAGCAACCCTGGATTATTAAAAGAGACAAAGCGTCATTTAGAAACTTTCGGCGATGATGGTTTGCGTACGCTTACGATTGCGCAGCGACGTGTAAGTGAA
ACGGAGTATTTGGACTGGAGCGCACGCTTTAAGAAGGCGAATTCTTCTCTGGAAGAAATTGACAAGCGCAAGAACGGTCAGTCGAACGAAATTGACAAGC
TTATGACGGAGATTGAGCATGATCTGGAAATGCTAGGTGCAACAGCAATTGAGGACAAGCTGCAGAATAATGTACCAAGATGTATCGCTAATCTGATGCG
CGCAGGAATGCGAGTGTGGATGCTTACGGGAGACAAGCAGGAGACCGCCATTAATATTTCTTATGCGTGCCAGCTCATGGATAGCGATATGGAGCAATAT
GTGTTCAACTGCGATCTGTATCCTACGAAGGACGCCATCCTTGCACAATTGCTGAGTGCAAGCGCCCATGTCCAGCAAGGTACCAGTCGTCATGCCGTAG
TGATTGACGGTGAGTGCTTGGAGATGACGCTGGCAGACGATCAGTGTCAGCAGGAGTTCTTGTCGCTGGCCATGGCTTGCGAGGCTGTGGTGTGCTGCCG
TGTATCACCCAGCCAGAAAGCTGAGGTAGTATCACTAGTGCGTGCTACGAACAGAAAGGTGCGAACGCTGGCGATCGGTGACGGTGCTAACGACGTCGCC
ATGATTCAGCGTGCGCATGTTGGCGTTGGTATCTCGGGTCAAGAGGGTATGCAAGCTGTGAATTCAAGCGACTATGCGATTGCGCAGTTTTATTTCCTGG
AGAAGCTGCTTTTGCACCATGGCCGGCTGAATTACAAGCGTATGGCCGTTCTGGTAGGGTACATGTTCTACAAGAATATTGTGATGGTGCTAGTGCAGTA
CTTTTATATGTTTTGCACGGGCTCCTCCGGCCAGAAGTTCTACGGCGAATTGGGCTTTCAGCTCTATAACGTCAGCTACACGTCCCTTCCTATCATTGTG
TTGGGTGTGTTTGACTACGACGTGCCTTTTGAAGTGAGTCGTTTCTTTCCCGAGCTGTACTTGGTTGGACCGCGCATGGAACTTTTCAACAACTACACGT
TTTTCAAGTGGATTTGCAGCGCGGTCTATGAGGCGGCTGTTATTTTTGTGTTCGTGGCTTACGCCTTCAACGAGAACCTATCTACTGTTGGCAGCGCGCC
TATGGTGCAGTATGGGCTGCTCGCGTTCACCATGGTGGTTTTGGTAGCCAATATCAAGTTGTCAATGGTGCAGA