Description :
From Genome Similarity Track
Location :
contig_24:458080- 459553
Transcript NameFunction/comments
g4609.t1hypothetical protein

Sequence
1473 bases(100 bases per row)
CTATCTAGCTAACGTTTATCATGACATGCAAAGTCAGATGGCCACCCTTCGAGGCTCTTGGAACCCATAATTTTAAGGAACCACCACCCGAGCCAGGAAT
GCCAAGCACATTCGATCTCCAACGATCCAGGTACAGCACTTTGTCCTGCAATTTCGAGACAGTGGAGTTCCAGGTTGCCGACCCGTGCGCATTGACGTCT
ACCTCCGCGATGCTTTCACCGCCCGAGTGAATGGTAACTGTCACATCTTTCGAGTCGATGCTCTTGAAAATGAGTTTCACGACGCCGTCCCTTTTTTCTT
CCACAGGCCGTAGCTGCCTACGAACGCTTCATCCACTGTCGTTAAACCCAGCGCGTCATATAGCGAACCATCGTCGATATCGCCAATAAATGAGGTGGGT
CCGCAAGTCGGTTGCACGAATTGGGATGCTAACCACACAAGTCTAGTTGGATCGAGACCAGACAGCATGACGAGCCCATAGTTCGTGACTTCGAGTATGT
ACTGAGACTCGGCTACAAATGACCCCCGTTGGTCACCCCCGTCGCCACGAGCTGCTCGATGATCACTCCGAAGGTTTTCCGTAGCAGGTCGCGAGTATCG
AACGCGGCCTCCTCCGTTTTATAGGACAGTAACTCGTTCATGCAGTTGTTGGTAGCTGTGGGGATGTCCCTCAGCACGAGCGAGGACCTGCTGATTTTCA
CTCGGACATCGTTAATCGTAGCTCCGGGAGTATTATTGCGAACATTGATAACCGAAGTCATAACGTGATCCGAGAGGCGTTTGAGCTGATATCCACACGT
TGAGTTTGAATCTAAAAAGTCCTGGAGCTCCTCCACGCTACCGGTAGCATCTGTTAGATCAACAACTGCAGTGGCGTTGGTGAGAAGGTTCATGACATTC
TTGGCGGACGAGAGGATTTCGTCGCCGTTGATGATAGCTTGCTTCACGATGGCTTCCACGATCATCATGACAATGCCGGTAAACTGCAAATTCGCCGGCA
CTGGTACGCCAATACAATGACACACTGCAACTGGCAAGTCCACGAGAACGACATCAGACTGGTAGGCCACGGCTAATAGCTCTTCAACAGCTCCTTGGGG
TGCCGTCGTTTTCTGGAATCTGATGTAGTAAATGAGAGACCTGAGCACGCCAACCACGTTTGCAGCGCAGAAGAAAGTCTGGCTTACTTTCTTGTAACCT
GAAAAAATGGCACCTAAGACGCCTGCCGTCGCCACATTAACCACTGCTGCCACCACAGCCACTGTTTTTTGCAGGATCTCCAGCGCACAGTTGTCATTTT
GAGGAATGCACTCCAAAAAACACTTCACGGGGTACGCTAGCGGACACTGAGCGATGCAGTAGTCATCGTCCAAGGTGTAGCCTGATGGACACACTTTGCT
GCTGTTGAAAAACTGCATCTGCCGGTAGCACGCTGAGTCTTTGGCAACCCCGACAGAGGGGCCTACCCAATTG