Description :
From Genome Similarity Track
Location :
Scaffold_178:45808- 47860
Sequence
2052 bases(100 bases per row)
CTCATCTTCTTGTATTTGCATCACTTCGAACTGATTCCGTTTAGCTCGATCAAGTTCAAATTTCTGTAACCATGCACCACAAATGAGGTTCGCTTCTCCC
ACCCATGTTTTATCATTATGACCCTTCCACCAGAATAGAAACTGTCGGTGTATTCTTCTATACCGCGTTTTTCGTCCCGATCGCACATCTCTAATACTGT
CCACCCCCTATTTTCCTTCAGCCAAATTACCTTCTCAACTTCCCCCCCCCGGAAGTATGGCTACATTGAAATCCACTCGTTTGGTTTCTTCCACCCCCAG
ACGTGCAACAGGTCGGTCAGGAAAACTTTGTACCAATTCCAGCTTGGATATGTACACGATCAGCAAAACCCTAAACCCTGTGAGGTTCCTTACACTTTTA
GCCGTACTGCGTGCTCCCCGCAATTCTTGATCACCCGAAATGGGCCATGCCACATGTGATCCAGCTTCCTGGCATATCCCTATTTCACTCAATCCAAATA
CATTCACATTTGGCTACCACATTTTTTTTCATGTGGCTCTTTATCATTATTGTGTTGATCGGCCCGGTCCTGAATGGCTTCTTTCAACCGGGTATTCACG
GTGGTCCGGGCATGTTGGTACTATCGCTGTATATGATAACGCCATCTCCTAAGGTCACTATCACGTGTTTTAGTGCACCCCAATTAAAGGGTTGCCTCCA
ACGTCGATCGCGTGTATCATCCGTGGATGAGATAAACGATGTATCACCACGGACTTGGTCATGCTCCGTATTGATAGCGAAGGTTAATTGCTCGTCATAC
TCATCCTAGTCTTAATGGTTCACATCAGTGACATACATCTTGAGCGCCCTGGTCAATGTTTGGACCATCTTTTCGGCGGTGCCATTTGCCTAAGGCCGAT
GGACCATTGTAGAACGTTTCTTTTGACCGGAAATACGGTTGAACTCGTGACATTAATTCGACATGAACCCAAGCTCGCAATCATGAAGAATAGATTCGCT
CGCCCCAAATCGCTGGAAGACGCATCCTTCATATCATTCCGCAATTGTTTGGTCCTTTTTCGACGAGCTAGCTTTCGCGATCACGTAGCCAGAAAACAAA
TCGACCCAAAGAATAAATTCATTTATTTCTTGAATGACTGTGGCAACGAAGGGTTATGATCTTTTCTCAACAATCTGAAAAGGGTATGTAGCTTGCATGT
TTCCGGGGGATTCTCCATGTAGCACCGGACATCCTTTCCTGGTTTCACATTCAGCACACATCCCCACATACTGTTGCACGCTTCAAAACAAACCTCTCGA
ATGAAAGTGTGATCTCACGTGGTGATACTAGCGGCCCACCCCTTGATGACCCTCTTCTAGACTTACACGGTAATGGTGTAGAATACCGTCTTGGAGCAAC
CAGACGAACAAGATCAGAACGGTCATCGGGATTTGTCGCCATCGCGGGCAAAAATACAACTATCCGCCTTCATGTACCACGTAGTCTGGGGCTATCACGG
CACTTGCTTTTACTTCTACAGCATCCATATCAGTTACATCTCCGACTGAGTTTGGCGATCCAACTTTCTTCGTCTTGCGCCTTTTTATGCGGTCAAGTCG
CATCTGCTGTACCACTTCTTCTTGCATAATAGCAAACGCATCATGCCTTCGCATAGTCGATCTTGTGATCTCCGCCACCTTGATCACTTAATCATTGCAC
GCTGGCGCCAATATCTTTTCCAGTCGGTTGATGACACTCAGATCGTGGCGATTCTGATTAGTTAGCATAACCATGCCTTTTTCAAGCTATAAAGAGGTGC
TAGCCAATCAATCCGCACTTTATTTCCAATCGCGCTTAGCGTGTAAGTACTCATGTGTCGGCCACAACCTGAGTTGATCCAGGTCTTTGTGGCGCAGTAT
TTTTAGCCCTGGTTCCTTGCAATCAATCTTACCCCGCATCTGCCCGATGACCAGGTTGGAATCTCCACAGATGACAACTCGCCCCCTTGTCTGCTTCGCT
AGCAGCTCGCAACTCAGCAGCAAGCCGTGATATTCTGCCTCGGTAACCGTTA